» Site Navigation
1 members and 589 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,069
Threads: 249,218
Posts: 2,572,787
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: Fluorescent ball pythons...I kid you not.
I personally think it's going to be FOREVER before they are able to get GFP into a reptile - consider you have to get the genome altered, get it in an egg, and then get that egg to hatch - so like - surgery. And depending on how much development goes on inside the parent snake, you might have to start the process before the egg is even laid.
(the first thing i wanted to do with GFP when i learned about it was put it in ball pythons. It seems a pretty tall order)
Last edited by Morphie; 11-21-2008 at 09:05 AM.
 Originally Posted by BT41042
Your going to Hell
-
-
Re: Fluorescent ball pythons...I kid you not.
 Originally Posted by Morphie
I personally think it's going to be FOREVER before they are able to get GFP into a reptile - consider you have to get the genome altered, get it in an egg, and then get that egg to hatch - so like - surgery. And depending on how much development goes on inside the parent snake, you might have to start the process before the egg is even laid.
Well, to do it efficiently, before you do any of that you first need the genome sequence for the ball python so you can determine where to best put the GFP tag. And to the best of my knowledge no one has gone out and sequenced the whole ball genome yet (anyone got a spare million bucks and the willingness to lend a few normal BPs for blood draws?)
Once you have that the process should actually be pretty "straight forward" in terms of already existing techniques.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Fluorescent ball pythons...I kid you not.
 Originally Posted by WingedWolfPsion
The neon mice certainly aren't suffering--they're going to live out their priveleged $40 lives being pampered by proud human owners. The glofish aren't suffering--they certainly are given more care in an aquarium than their ordinary zebra fish brethen. The same will be true of other genetically modified pets.
Bet'cha they won't be used as feeders...
 _____________________________________________
Ivy
_____________________________________________
BPs: 1.0 Normals,1.0 Pastels, 0.1 Dinkers
Other Herps:
6.20 Bearded Dragons (Hypos, Trans, Leathebacks, Reds, etc.), 1.1 Knob Tail Geckos
Other:
0.1 Mini American Eskimos, 1.0 Chihuahuas, 0.1 Terrier Mixes, 1.0 Chihuahua/Toy Fox Terrier Mixes
1.0 Double Rex, 0.1 Beige Ruby Eyed Dumbo, 0.1 Hairless PEW
-
-
Registered User
Re: Fluorescent ball pythons...I kid you not.
They are interesting, but they only glow under a special light.
Would it even work with ball pythons? The rat's hair doesn't glow, would scales? I don't know that much about the genetic make up of scales so I have no idea.
-
-
Re: Fluorescent ball pythons...I kid you not.
 Originally Posted by Mike Russell
Would it even work with ball pythons? The rat's hair doesn't glow, would scales? I don't know that much about the genetic make up of scales so I have no idea.
This is why I said you need the genome sequence to first before you take the next step. In these specific mice the hair does not glow but there are GFP animals that have glowing hair. ANDi the monkey is an example. IIRC the rabbits have glowing hair too... If the GFP tag is specifically inserted in a chosen location one could get them to glow, even in a patter specific manner. If you just do a pell mell GFP insertion then who knows what will and will not glow...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Fluorescent ball pythons...I kid you not.
 Originally Posted by asplundii
This is why I said you need the genome sequence to first before you take the next step. In these specific mice the hair does not glow but there are GFP animals that have glowing hair. ANDi the monkey is an example. IIRC the rabbits have glowing hair too... If the GFP tag is specifically inserted in a chosen location one could get them to glow, even in a patter specific manner. If you just do a pell mell GFP insertion then who knows what will and will not glow...
do you have any citations of animals with glowing hair? I'd be interested to see that - i was under the impression proteins would be somewhat dysfunctional in the non-aqueous environment that is dead cells that make up our hair and therefore hair couldn't be caused to glow.
But i might just be horribly wrong.
 Originally Posted by BT41042
Your going to Hell
-
-
BPnet Veteran
Re: Fluorescent ball pythons...I kid you not.
 Originally Posted by Morphie
They use this gene to look at what's going on in mice who are intentionally given the genes for a genetic anomaly homologous with one present in humans. That does not mean that all mice that are given GFP coding regions have one of the controlled genetic problems - they can make healthy GFP mice just as readily as inflicted ones. It's even easier.
The genetic problems you're thinking of are likely located elsewhere on the genome - probably not even the same chromosome - they have nothing to do with GFP.
what picture are you looking at? I'm sure if they know enough to alter genomes, they know what species they're working with.
holy heck, people.
i guess you didnt watch the whole show that included this info directly from the first place to even sequence the rats genes.
i guess that uni. just lied about it
-
-
BPnet Veteran
Re: Fluorescent ball pythons...I kid you not.
 Originally Posted by nixer
i guess you didnt watch the whole show that included this info directly from the first place to even sequence the rats genes.
i guess that uni. just lied about it
... ?
I don't watch TV to learn about science, generally. I get my science from publications and texts (and my professors).
I don't know why you're still talking about rats. The mouse was the first gfp mammal to be made in a lab, and it's the only gfp mammal that's commercially available right now, afaik.
 Originally Posted by BT41042
Your going to Hell
-
-
Re: Fluorescent ball pythons...I kid you not.
Yeah, the fluorescent mice have been available to laboratories for a long time now, and in just a couple of weeks, everyone can have one.
Rats won't be available that way for some time.
Like glofish, I don't expect these mice will look exactly normal under normal lighting either--like glofish, blue lights will show them off best during the day, and blacklights will show them off best at night. But they're going to look interesting under normal lighting too.
They do not glow in the dark--they fluoresce when exposed to certain wavelengths of light. Those wavelengths are found in white light, but the effect is more pronounced when the proper wavelengths are concentrated.
Fluorescent rat: http://kumikae01.gen-info.osaka-u.ac.../GreenRatE.cfm
Fluorescent cats: http://www.care2.com/news/category/animals/fluorescent
Fluorescent pigs: http://www.trendsforpets.com/pets/glowing-pigs/
Fluorescent rabbit created as a work of art: http://www.medienkunstnetz.de/works/gfp-bunny/
Possible failed fluorescent monkey: http://www.genomenewsnetwork.org/art..._01/ANDi.shtml (He carries the genes, but doesn't fluoresce yet).
Last but definitely not least...
Spider goats: http://news.bbc.co.uk/2/hi/science/nature/889951.stm
biopharmaceutical hen: http://www.mult-sclerosis.org/news/D...wChickens.html
biopharmaceutical sheep: http://library.thinkquest.org/C0122429/history/1990.htm
Mice are the most commonly created transgenic animals today, rats probably come in second place.
Lots of technical stuff on why GFP animals (fluorescent animals) aren't that hard to make: http://www.biomedcentral.com/1471-2202/3/7
You do NOT have to know the entire genome of an animal in order to introduce GFP genes. Genetic engineering is much messier than you realize. And all you really need is a freshly laid ball python egg, and a male and female ball python, to get started. (And a lot of money and special equipment).
The beauty of these transgenic animals is that once you have a pair of them, you don't have to genetically engineer any more. You can go on and breed them normally and they'll keep on reproducing that added trait.
Once GFP production is added to the genes of some ball pythons, they will be able to be bred and crossed into other ball python lines, the same way we do to spread other genetic traits. I imagine this will cause a big stink--but people will get over it, since these animals will undoubtedly be worth quite a lot of money. It seems obvious that white snakes will show off GFP best. Their scales are clear. I predict that in the long run, GFP ball pythons will be just another morph...if this company ever actually gets around to producing them, as they hope to.
-
The Following User Says Thank You to WingedWolfPsion For This Useful Post:
-
BPnet Veteran
Re: Fluorescent ball pythons...I kid you not.
I actually got to do this process in my Genetics lab with E. coli. It was very cool to see.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|