» Site Navigation
1 members and 1,243 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,146
Posts: 2,572,379
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: How much money do you think people like RDR and BHB make a year?
No one will know for sure how much they make. But you can be sure that if there overhead is high, they must be getting by enough to put up with it.
Bhb's myspace says he makes over 250k a year... Thats not too shabby if you ask me...
-
-
BPnet Veteran
Re: How much money do you think people like RDR and BHB make a year?
I can give you a quick breakdown of my business.
I produce around 750 balls a year, plus some colubrids (300 - 400), some boa's, some retics (this year hopefully). I do around $500,000 a year in total sales, not bad for working at home with animals I love. HOWEVER my costs are huge.
$1,000 a week in rodents
$800 a month in utilities
$1,000 a month in advertising / show expenses
$10,000 a year with superior
$10,000 a year in upgrading / adding new racks
$20,000 this year in moving costs
$30,000 a year minimum in upgrading my own collection with new animals.
I make more than enough for a comfortable living and pay all of my bills without much trouble however I don't really pay myself for my time. I have not been on a real vacation in 8 or 9 years. I'll be honest, I don't put anywhere near enough money away for retirement and live fairly frugally.
I've got money in the bank, but again with such high overhead, one or two bad months could drain saving really quickly as my overhead does not change even in the winter when I'm no longer really have anything to sell.
Support my efforts to raise awareness and donations to the Alzheimer's Association in honor of my Grandfather Eugene......
www.awalktoendalzheimers.com
"No man's life, liberty or fortune is safe while our legislature is in session." - Benjamin Franklin
-
The Following 15 Users Say Thank You to neilgolli For This Useful Post:
- + Show/Hide list of the thanked
-
Bruce Whitehead (11-12-2008),casperca (11-12-2008),dprince (11-12-2008),Drew87 (11-12-2008),filly77 (11-13-2008),JasonG (11-12-2008),Jolynn_2003 (11-13-2008),kk1020man (11-13-2008),Laooda (11-12-2008),Microddot (11-12-2008),munding (11-12-2008),Peter Williams (11-12-2008),Royal Morphz (11-12-2008),Spaniard (11-12-2008),TomSundin (11-12-2008)
-
BPnet Veteran
Re: How much money do you think people like RDR and BHB make a year?
 Originally Posted by neilgolli
I can give you a quick breakdown of my business.
I produce around 750 balls a year, plus some colubrids (300 - 400), some boa's, some retics (this year hopefully). I do around $500,000 a year in total sales, not bad for working at home with animals I love. HOWEVER my costs are huge.
$1,000 a week in rodents
$800 a month in utilities
$1,000 a month in advertising / show expenses
$10,000 a year with superior
$10,000 a year in upgrading / adding new racks
$20,000 this year in moving costs
$30,000 a year minimum in upgrading my own collection with new animals.
I make more than enough for a comfortable living and pay all of my bills without much trouble however I don't really pay myself for my time. I have not been on a real vacation in 8 or 9 years. I'll be honest, I don't put anywhere near enough money away for retirement and live fairly frugally.
I've got money in the bank, but again with such high overhead, one or two bad months could drain saving really quickly as my overhead does not change even in the winter when I'm no longer really have anything to sell.
Do you do most of your sales directly to the customer or do you wholesale most of the animals out?
Just curious...
Also how many shows a year do you do?
I hope you dont mind me asking...
-
-
Re: How much money do you think people like RDR and BHB make a year?
BHB has a nice facility, but like Robin has said, the overhead costs has got to be insane. I think Neil laid it out nicely.
-
The Following User Says Thank You to littleindiangirl For This Useful Post:
-
Re: How much money do you think people like RDR and BHB make a year?
Now are we talking what the owners pocket in profit or what the business turns. Cause like Neil said your overhead is extream when running a business and doing it right. I'm a small small mirco breeder and my overhead is still acouple of hundred dollars a month and I make 0 profit.
I'm sure they do well but I think that any sucessfull business owner knows where their profit celing is and they don't push it.
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: How much money do you think people like RDR and BHB make a year?
There is no doubt that as you get bigger your overhead increases and some of your profit gets eaten up. I always say I would never do what I do for the money, but I wouldn't work so hard if I didn't get paid to do so. I love what I do and you can't put a dollar amount on that. We are verfy fortunate to make very good money doing something that I only dreamed that I would do when I was younger. In the end if I made the same as I could working a normal job I would be ten times happier. I've also been lucky to make a lot more then a normal job. for me the more I make the more I can buy snakes. I'm like Kev from NERD, we live pretty modest for the income we bring in. It gives us the the chance to reinvest into more animals that I want to work with. This life isn't for everyone, it's a ton of work and takes deligence, but if you really have a passion for it, the income can be great and the journey is pricless. Thanks, Brian(BHB)
-
The Following 15 Users Say Thank You to BHB For This Useful Post:
- + Show/Hide list of the thanked
-
AaronP (11-13-2008),broadude (11-13-2008),daaangconcepts (11-13-2008),dprince (11-12-2008),Drew87 (11-12-2008),filly77 (11-13-2008),Jolynn_2003 (11-13-2008),Laooda (11-12-2008),MPenn (11-13-2008),munding (11-12-2008),Peter Williams (11-12-2008),pilot511 (11-15-2008),Royal Morphz (11-12-2008),TomSundin (11-12-2008),waltah! (11-13-2008)
-
Re: How much money do you think people like RDR and BHB make a year?
Not sure where I heard it but somewhere on RDR's site he mentioned that since he started he has made around $800K. So spread that out over the time he has been in the game and you get an estimate.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: How much money do you think people like RDR and BHB make a year?
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
BPnet Veteran
Re: How much money do you think people like RDR and BHB make a year?
I think it's a very high risk business.
Overhead costs are significant and constant. You spend lots of money to produce the product, and it keeps costing you until you sell it.
The product is perishable and high-end morphs are never guaranteed.
I'd think you'd be upside-down in the business for a number of years to get going, and the risk of going upside-down again never goes away. All it takes is a contagion or a power failure to wipe you out.
It's amazing to me that anyone can really succeed in the business. I have loads of respect to the few that have managed to do it
Augie 1.0.0 Lemon Pastel BP
Rio 1.0.0 South Brazilian BCA
Blaze 0.1.0 Brazilian Rainbow Boa
-
-
BPnet Veteran
Re: How much money do you think people like RDR and BHB make a year?
 Originally Posted by JasonG
Do you do most of your sales directly to the customer or do you wholesale most of the animals out?
Just curious...
Also how many shows a year do you do?
I hope you dont mind me asking...
Jason, I don't mind you asking at all. Some breeders don't see the $'s or production #'s as anyone else's business however I believe that to anyone in this hobby for more than a few years, its more than a hobby and at some level a business due to the amount of time and money they have invested and they are looking for some type of return. Thus I could not in good faith sell animals as a "investment" if I was not confident enough to share my experiences if asked.
I've wholesaled more this year than I ever have however that is mainly due to moving twice this year and the time, energy and effort those moves have taken. I think that I've shorten my life by 10 years in the last 6 months.
Total I will do around 25 shows this year, counting Cleveland and Columbus as 2 shows that are held the same weekend each month. I've sold animals to more overall customers however the average sale has been considerably less than in previous years. I've had more repeat buyers this year than any other year that I've been in business but again the average transaction has been lower.
I live a great life and could not picture it any other way but its not for the faint at heart. I could not have made it threw this year without Justin's FULL time help. We put in a ton of hours and its a lot of hard work. With the economy the way that it is and will likely be for the next several years to come we truly appreciate each and every sale and the fact that we are able to make a living doing what we love.
Support my efforts to raise awareness and donations to the Alzheimer's Association in honor of my Grandfather Eugene......
www.awalktoendalzheimers.com
"No man's life, liberty or fortune is safe while our legislature is in session." - Benjamin Franklin
-
The Following 4 Users Say Thank You to neilgolli For This Useful Post:
JasonG (11-12-2008),Muze (11-12-2008),Royal Morphz (11-12-2008),Spaniard (11-12-2008)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|