Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,507

3 members and 1,504 guests
Bogertophis, cboltsd, dakski,
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Search Forums

» Today's Birthdays

None

» Stats

Members: 76,060
Threads: 249,213
Posts: 2,572,750
Top Poster: JLC (31,651)
Welcome to our newest member, TillyMintz8613
Results 1 to 2 of 2

Thread: Branches

Threaded View

  1. 11-06-2008, 09:22 AM #2
    asplundii
    asplundii is offline
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Branches

    A lot of small holes??

    If so it could be cholla you are looking for.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
    Reply With Quote Reply With Quote

  2. The Following User Says Thank You to asplundii For This Useful Post:

    betoiguanas (11-09-2008)
« Previous Thread | Next Thread »

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  

Forum Rules
Powered by vBadvanced CMPS v4.2.1