» Site Navigation
0 members and 907 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,105
Posts: 2,572,113
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: A Very Different Albino
Huh, thats pretty cool to know! I wonder if it's a kind of guarantee that the axanthic lookers are actually 100% het since it was a hetXhet breeding. I guess you could sort of prove that by breeding that girl back to dad in a few years and seeing if all the "normals" come out looking that way. She's pretty dang cool Albey glad to hear maybe your luck has turned around some with the recessives .
~Adam~
BPs: 3.9 Normals, 1.0 Spider, 1.1 Pastels, 0.1 100% Het Hypo, 1.0 Cinnamon, 0.1 Pinstripe, 0.1 Albino 1.0 Bumblebee .
Bloods: 0.1 Marter line red, 1.0 Het T+ albino red.
Colubrids:1.1 Western Hogs, 0.0.1 Tri-Color Hognose, 1.0 Albino Cal King,
-
-
-
-
Re: A Very Different Albino
Too bad they go to normal . But that albino is going to be sweet!
-
-
Re: A Very Different Albino
Thank again everyone. I would still like to hear from anybody that has more information on whether or not the non-Axanthic looking ones can still be Het with the Blush Albinos.
 Originally Posted by MarkS
Thats very cool Albey, Hypoxanthic babies. Maybe you should work those into another axanthic line to see if it intensifies the axanthic look, or maybe work it into a cinnamon or pastel line to see if it makes a good modifier. I think it would be a fun project.
Are those babies 66% possible hets? Or are they 100% hets?
Mark, unfortunately the Axanthic looking ones turn completely normal looking after a few sheds so I don’t think they would add much to the true Axanthic.
It was a Het to Het breeding so they would be 66%.
Here is a picture I took of the one Female I kept from the 2006 clutch.

Here is a picture of the same Female that I just took.
-
The Following User Says Thank You to Albey For This Useful Post:
-
Re: A Very Different Albino
 Originally Posted by Albey
Thank again everyone. I would still like to hear from anybody that has more information on whether or not the non-Axanthic looking ones can still be Het with the Blush Albinos.
I am just shooting from the hip on this as I do not have any real background on blushing albinos but I am half inclined to think that what may cause this blushing and the axanthic-looking animals is the result of some type of promoter/expression regulator mutation. And if that is the case then there is the possible it is not linked to the albino loci. You would need to do some significant breeding experiments to prove this out though... And until that is done I, personally, do not think you can say one way or the other that the normal looking are any less het than the axanthic-looking. But that is only based on what I know of albino blushes from reading this thread and this thread alone.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: A Very Different Albino
Albey,
Congrats on finally getting something out of that pair. That is a very interesting clutch, and a very beautiful Albino. When I first looked at it, it reminded me of what Kevin (NERD) used to call faded Albinos. If memory serves me right, he even hatched Faded Albino Spiders. He may even have some of those pics on his new site.
Congrats,
-
-
BPnet Veteran
Re: A Very Different Albino
WOW!!!! I love low contrast!!! Beautiful little snake!
~*Luna*~ The crazy Sagittarius/Snake BP Lady
Cal and Ki's Proud Mommy.
~~* Goddess Bless*~~
1.0.0- Normal Ball Python (Kyros "Ki")
0.1.0- Normal*Spider sibling*Ball Python(Calypso"Cal")
1.0.0- Betta fish (Leonidas "Leo")
  Steve Irwin (2/22/62 - 9/4/06)  
Sagittarius- Shockingly blunt since the beginning of time!

-
-
BPnet Veteran
Re: A Very Different Albino
alright so i just hatched a clutch of 6 from het x het also. the babies bloodline comes from bob clark. i have an albino (not quite that faded but faded) and 2 of the other 3 are axanthic lookin like yours. have you tried breeding them back yet?
pin albino bp in the making 
-
-
Re: A Very Different Albino
I have produced these in the past and the Axanthic looking babies are the Hets for Yellow Blush Albinos.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|