Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,025

1 members and 1,024 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

Jchipowsky (44)

» Stats

Members: 75,945
Threads: 249,144
Posts: 2,572,366
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 58

Threaded View

  1. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: It's LOSE, not LOOSE!!!

    Interesting thread. I agree with lose/loose and your/you're. Always bugged me and always will.

    However, none of those things beat the below text taken from another forum I frequent. I will never understand how anyone could type/think in this manner...

    Well, 'Actually' ... Yes!

    That's-Rhoughly 'What'-He Said to Robert-Gibson in The Early-Nineties. I-Don't 'Know' Exactly What Colourful-Language was Used ... but it-was Enough to Cause The-Poor-Guy to-Have-to Phone-Home to His-Parents! >(*~*)<

    Lets-Face-it He's Renown for Some-of The Most Colouful-Language on The-Planet.

    I-Actually 'Heard' from One-of-The-Two Gay-Guys of The New-South-Wales Society 'Exactly' What He-Said-to-Them When They Turned-up on His Door-Step for-R 'Spot'-of-Tea One Afternoon ... so-I-Can Well-"IN"-Magine How Such-R Selection of Words Could Shiver-the-ol'-Timbers, so-to-Speak.


    ****
    You Don't Live-Here You Don't-'Know' Kind'a'-Thing.

    ****

    Though You Have to Ask-Yourself The-Question: 'Why' Every-other State in-Australia Has a CP-Society or Group(ing)s and Yet WA Does-'NOT' ... The Place with The Most Diverse and Concentrated Grouping of CPs on The-Planet & 'Why' The One in The Late-Seventies / Early-Eighties 'Seemingly' Vapourised for no-real-reason Never-to-be-Seen-again sort'a'-Thing!!!???

    As-to Publications I-vaguely-Remember There were a Flurry of Publications by The-Authorities in The Nineties When it Appear that The Original-Discoveres of Certain-species weren't Going-to-be Honoured ... definitely a No-no among Professional-Botanists. Correct-Me, If-I'm-Wrong ... but I-Think Plaguerism in any-Guise is frowned-upon in Most-Field-of-Endeavour. I've Certainly-Heard through-the-Grapevine that a Number of His / Their? so-called 'Friendships' were Irrevocably-'Broken' because of-These Indiscressions.

    As-to-Collaborations ... These Apparently Fall-through For Some-'Strange' but-Apparently Consistent-Reason. I-'Know'-Myself, Being R-Person that Does-All-the-Extras, that I'd only Dissove R-Collaboration if-I Found-(out) that I-was Apparently Doing Most-if-not-All of The-Work and in-R-Way being 'Used'. This Seems to Tie-in or Tally-well with What I've Read in the Old Black-&-White CPNs as-well-as CPNAs [Carnivorous Plant Newsletter(s) of Australia] that I-Have Mentioned-before in-This-Thread.

    Actually The Word: "USE" was the Precise-Word Profferred to Dissolve the Twenty-or-more Year 'Friendship' of One-of-Our Past-Presidents. I-Remember He made a Point of Drawing-Our Attention to The-Fact that He-had 'Not' Said: 'I-Have No-Use for-You Anymore' ... but Rather & More-Pointedly Said: "I-Can't USE-You Anymore". I-Can't 'Fathom' 'Why' Someone Would make such-an-Effort after Twenty-years ... let-alone before VOIP-Phone-Prices.

    I-Have R-Letter in My-Filing-Cabinet from Someone in-Victoria, Who Knew-Him, Went-on-Field-Trips with-Him and Who Had Long Telephone Conversions with-Him, Stating as-R-Joke that Allen-Lowrie Lives for Only Two-Things: "Money-&-Ego".

    To-Me This Joke Seems to Ring-Truer-&-Truer as The Years Go-by and Appears to-be Connected in- Someway to Much-of-The-Above.

    If-I Live Long-enough I-Hope to Oneday Read a Bestseller about The-Man-Himself and All-that Actaully or 'Really' Went-on over the-Years. I-Reckon I-Wouldn't be-able to Put-it Down and-Would Read-it in 'One'-Sitting ... Surrounded with The Remains of Countless Cups-of-Coffee. >(*U^)<
    If you really want to hurt your brain here is 3 pages of this guy going on like this.

    http://www.cpukforum.com/forum/index...pic=28623&st=0

    So I look at it in a practical way that it could really be worse than someone using "your" for "you're"
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Kaorte (10-23-2008)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1