» Site Navigation
0 members and 1,263 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,142
Posts: 2,572,364
Top Poster: JLC (31,651)
|
-
Registered User
Re: It's LOSE, not LOOSE!!!
 Originally Posted by Inknsteel
I couldn't agree more. I think that people are starting to care less and less about proper spelling and grammar. I actually read an article not too long ago about some professor in the UK who truly believed (this is on a college level mind you) that rather than mark off for incorrect spelling, we should adapt the English language to include common misspellings as "alternate" spelling. I wish I could find the article again, but I have tried in vain. I remember reading it on foxnews.com. I just couldn't believe what I was hearing. Essentially this professor believes that we should adapt our language to view spelling errors as acceptable rather than enforce the established rules of the language. In my opinion, either our early education system is going downhill fast, or in the age of the internet, we've stopped caring about menial things like spelling, punctuation and grammar as long as we get the general point. Does anyone else remember English studies somewhere around the third grade? In the English language, the entire meaning of a sentence can be changed simply by adding or changing a single punctuation mark.
Sorry for the mini-rant. This is also a HUGE pet peeve of mine. Seriously people, if you're old enough to get on the computer, go online, register for the forum, read and post in threads, you can obviously speak English. You should also be able to write how you speak. When I personally get to a post and the first sentence is broken English or "L33T" speak, I will pass right by it. If you can't take the time to write your post in proper English, I won't waste my time giving you an intelligent reply...
/soapbox
Amen honey. And I'm not just saying that. I completely agree. The more we let people slide on grammar and punctuation, the less intelligent we seem. Eventually, people are going to BE less intelligent because of it. (Huge pet peeve of mine too)
-
-
Re: It's LOSE, not LOOSE!!!
 Originally Posted by simplechamp
Yeah, it seems like I hit a nerve here. I don't know why people get so defensive. I'm not calling anyone dumb, or asking anyone to stop doing it.
You might not be, but I certainly AM!
-
-
BPnet Veteran
Re: It's LOSE, not LOOSE!!!
The thing that really irks me is when people use "seen" wrong.
It is NOT "I seen that" or "I seen this" You can't "seen" anything.
It's "I saw this" or "I saw that"
"Seen" is "Have you seen my dog?" "seen" is a participle, figure it out people.
"If I were stranded on a desert island and could only have one book, record and person...I'd probably die of exposure."
czphotography
-
The Following 3 Users Say Thank You to panthercz For This Useful Post:
ADEE (10-23-2008),Inknsteel (10-23-2008),RoyalGuardian (10-23-2008)
-
Re: It's LOSE, not LOOSE!!!
 Originally Posted by panthercz
The thing that really irks me is when people use "seen" wrong.
It is NOT "I seen that" or "I seen this" You can't "seen" anything.
It's "I saw this" or "I saw that"
"Seen" is "Have you seen my dog?" "seen" is a participle, figure it out people.
Someone paid attention in English class. You get a gold star for the day!
-
-
Re: It's LOSE, not LOOSE!!!
Interesting thread. I agree with lose/loose and your/you're. Always bugged me and always will.
However, none of those things beat the below text taken from another forum I frequent. I will never understand how anyone could type/think in this manner...
Well, 'Actually' ... Yes!
That's-Rhoughly 'What'-He Said to Robert-Gibson in The Early-Nineties. I-Don't 'Know' Exactly What Colourful-Language was Used ... but it-was Enough to Cause The-Poor-Guy to-Have-to Phone-Home to His-Parents! >(*~*)<
Lets-Face-it He's Renown for Some-of The Most Colouful-Language on The-Planet.
I-Actually 'Heard' from One-of-The-Two Gay-Guys of The New-South-Wales Society 'Exactly' What He-Said-to-Them When They Turned-up on His Door-Step for-R 'Spot'-of-Tea One Afternoon ... so-I-Can Well-"IN"-Magine How Such-R Selection of Words Could Shiver-the-ol'-Timbers, so-to-Speak.
****
You Don't Live-Here You Don't-'Know' Kind'a'-Thing.
****
Though You Have to Ask-Yourself The-Question: 'Why' Every-other State in-Australia Has a CP-Society or Group(ing)s and Yet WA Does-'NOT' ... The Place with The Most Diverse and Concentrated Grouping of CPs on The-Planet & 'Why' The One in The Late-Seventies / Early-Eighties 'Seemingly' Vapourised for no-real-reason Never-to-be-Seen-again sort'a'-Thing!!!???
As-to Publications I-vaguely-Remember There were a Flurry of Publications by The-Authorities in The Nineties When it Appear that The Original-Discoveres of Certain-species weren't Going-to-be Honoured ... definitely a No-no among Professional-Botanists. Correct-Me, If-I'm-Wrong ... but I-Think Plaguerism in any-Guise is frowned-upon in Most-Field-of-Endeavour. I've Certainly-Heard through-the-Grapevine that a Number of His / Their? so-called 'Friendships' were Irrevocably-'Broken' because of-These Indiscressions.
As-to-Collaborations ... These Apparently Fall-through For Some-'Strange' but-Apparently Consistent-Reason. I-'Know'-Myself, Being R-Person that Does-All-the-Extras, that I'd only Dissove R-Collaboration if-I Found-(out) that I-was Apparently Doing Most-if-not-All of The-Work and in-R-Way being 'Used'. This Seems to Tie-in or Tally-well with What I've Read in the Old Black-&-White CPNs as-well-as CPNAs [Carnivorous Plant Newsletter(s) of Australia] that I-Have Mentioned-before in-This-Thread.
Actually The Word: "USE" was the Precise-Word Profferred to Dissolve the Twenty-or-more Year 'Friendship' of One-of-Our Past-Presidents. I-Remember He made a Point of Drawing-Our Attention to The-Fact that He-had 'Not' Said: 'I-Have No-Use for-You Anymore' ... but Rather & More-Pointedly Said: "I-Can't USE-You Anymore". I-Can't 'Fathom' 'Why' Someone Would make such-an-Effort after Twenty-years ... let-alone before VOIP-Phone-Prices.
I-Have R-Letter in My-Filing-Cabinet from Someone in-Victoria, Who Knew-Him, Went-on-Field-Trips with-Him and Who Had Long Telephone Conversions with-Him, Stating as-R-Joke that Allen-Lowrie Lives for Only Two-Things: "Money-&-Ego".
To-Me This Joke Seems to Ring-Truer-&-Truer as The Years Go-by and Appears to-be Connected in- Someway to Much-of-The-Above.
If-I Live Long-enough I-Hope to Oneday Read a Bestseller about The-Man-Himself and All-that Actaully or 'Really' Went-on over the-Years. I-Reckon I-Wouldn't be-able to Put-it Down and-Would Read-it in 'One'-Sitting ... Surrounded with The Remains of Countless Cups-of-Coffee. >(*U^)<
If you really want to hurt your brain here is 3 pages of this guy going on like this.
http://www.cpukforum.com/forum/index...pic=28623&st=0
So I look at it in a practical way that it could really be worse than someone using "your" for "you're"
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
BPnet Veteran
Re: It's LOSE, not LOOSE!!!
That doesn't make any sense! It takes more effort to include the dashes and use caps on every word than to just type it out normally. Why would he even bother? Oy, some people...
-
-
BPnet Veteran
Re: It's LOSE, not LOOSE!!!
 Originally Posted by Mindibun
As an English major, and a grammar freak, I'm totally with you. The one that bothers me the most is when people mistake "your" and "you're". If you're not sure, just say the whole thing rather than the contraction. Its not "your stupid." Its "you are stupid." Hence, "you're."
Actually, I had a little funny list of grammar rules in my sig here once, and I got jumped on by everyone. They said they felt offended and whatnot.  Sorry, it's not my fault you can't understand elementary English rules, and its definitely not my fault that you feel the need to put down everyone who does.
I agree with both of you!! Of course people find it offensive because some people don't really care if they spell and have the grammer of a 5 year old. My pet peeves are when people think they are better than me just because they have been doing something longer(I realise they might know alittle more than me but they are not better than me). I am one of those people who research until my brain turns to mash. I quite literally HATE people that get an animal and havent done a lick of research on its behalf. I also HATE people that think that once the animal gets to big they will just get rid of it. I very strongly disike people that won't even give snakes a chance. But my greatest pet peeve is when people try to tell me that I'm a devil worshipper (I'm a Goddess worshipping Pagan). You can tell I am a Sagitarius Snake because I do not tolerate ignorance very well. I may seem cynical, that may be so but look deep inside yourself and you will see that you too HATE stupid people. But given our lives we all are Stupid at one point whether to us or to others.
~*Luna*~ The crazy Sagittarius/Snake BP Lady
Cal and Ki's Proud Mommy.
~~* Goddess Bless*~~
1.0.0- Normal Ball Python (Kyros "Ki")
0.1.0- Normal*Spider sibling*Ball Python(Calypso"Cal")
1.0.0- Betta fish (Leonidas "Leo")
  Steve Irwin (2/22/62 - 9/4/06)  
Sagittarius- Shockingly blunt since the beginning of time!

-
-
Re: It's LOSE, not LOOSE!!!
 Originally Posted by RoyalGuardian
I agree with both of you!! Of course people find it offensive because some people don't really care if they spell and have the grammer of a 5 year old. My pet peeves are when people think they are better than me just because they have been doing something longer(I realise they might know alittle more than me but they are not better than me). I am one of those people who research until my brain turns to mash. I quite literally HATE people that get an animal and havent done a lick of research on its behalf. I also HATE people that think that once the animal gets to big they will just get rid of it. I very strongly disike people that won't even give snakes a chance. But my greatest pet peeve is when people try to tell me that I'm a devil worshipper (I'm a Goddess worshipping Pagan). You can tell I am a Sagitarius Snake because I do not tolerate ignorance very well. I may seem cynical, that may be so but look deep inside yourself and you will see that you too HATE stupid people. But given our lives we all are Stupid at one point whether to us or to others.
Gotta tell ya, the above is a pretty ignorant statement. Also fairly pretentious.
You have the nerve to tell me who I hate? And that it is ok because you do?
You "quite literally HATE" people that don't research as you do?
You dislike people based on the choices, which have nothing to do with you, they have made regarding snakes. Excellent criteria there. Do you step on worms because the make snakes look slimy?
Perhaps you spoke in a rush, but I doubt it.
You've got some serious issues that you may not be seeing though your lenses, coated with arrogance and hubris as yours seem to be.
I may not be very smart, but what if I am?
Stinky says, "Women should be obscene but not heard." Stinky is one smart man.
www.humanewatch.org
-
-
BPnet Veteran
Re: It's LOSE, not LOOSE!!!
Hahahahaha, how many of you guys have re-read your post like a million times before hitting submit to this thread? Because if you did make any spelling or grammar mistakes you wouldn't look too smart, especially the OP!
*re-reads post a million times*
Geez I hope there's no mistakes in there.
-
-
BPnet Veteran
Re: It's LOSE, not LOOSE!!!
 Originally Posted by blackcrystal22
Honestly, I hate when people don't know how to talk properly. Even on the internet.
Your kidding me right?
The proper usage should be
"I hate it when people don't know how to speak properly?"
Shouldnt it? (lol)
This thread is hilarious! I dislike it when people use caplock on random words in their sentences... oh yeah.. and randomly press enter in the middle of their statement.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|