» Site Navigation
1 members and 1,833 guests
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.
» Today's Birthdays
» Stats
Members: 75,895
Threads: 249,089
Posts: 2,572,053
Top Poster: JLC (31,651)
|
-
Registered User
Best brand of custom PVC caging?
Hi all,
I just got my ball python but I am already thinking about his cage upgrade in about a year, and I would like to know what brands people have liked for custom PVC enclosures. He is in a PVC enclosure now. It is the first time I have had a PVC enclosure and I've decided I really like them.
I would like a freestanding unit with a 2ftx2ftx4ft enclosure on the bottom, a 1ftx2ftx4ft spacer in between for lighting/equipment, and two enclosures on top: a 1ftx2ftx3ft enclosure for my crested gecko, and a 3ftx2ftx3ft enclosure for another snake of an undecided species.
Here is my wishlist:
-Black PVC body
-Glass sliding doors (hinged for smallest tank)(acylic door is the only thing I don't like about my current PVC tank!)
-Full perforated metal screen tops
-Must be separate enclosures for ease of movement
-Bottom edges must be sealed for bioactive
-Must be able to choose placement of all ports and vents
Anyone have any suggestions? Thanks in advance!
_________________________________________________________________________
0.0.1 Correlophus ciliatus "Aiko"
1.0.0 Python regius "Atticus"
"Those who teach the most about humanity, aren't always human." -Donald Hicks
-
-
I bought my boa an 8ft PVC enclosure from Reptile Kages and I've been extremely happy with it. Could choose how far the venting went along the back, there were options for meshed light cut outs for either end, sliding glass doors with option of a locking mechanism (I dont think they have any hinged for the small enclosures), and they all have a black color option I'm pretty sure.
Why do you want a full mesh top? I don't know about cresties, but for your BP it's so much easier to maintain humidity levels with a solid top. I bought RHP from ProHeat and they've amazing; so much better than the UTHs I've I had before. They are kind of pricey between the panels (I needed 2 for the size enclosure I got) and thermostat but imo worth every penny.
--------
1.0 Husband
0.1 Colombian BCI (Satin)
0.1 Spider BP (Loki), R.I.P...  We will never forget you...
-
The Following User Says Thank You to xFenrir For This Useful Post:
-
The best fully custom cage builder I have used is FocusCubed. They can build pretty much anything. Just be aware that you will have to pay a premium for the level of customization and also have a longer wait time
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Bogertophis (08-08-2023),Homebody (08-08-2023)
-
Registered User
Re: Best brand of custom PVC caging?
 Originally Posted by xFenrir
I bought my boa an 8ft PVC enclosure from Reptile Kages and I've been extremely happy with it. Could choose how far the venting went along the back, there were options for meshed light cut outs for either end, sliding glass doors with option of a locking mechanism (I dont think they have any hinged for the small enclosures), and they all have a black color option I'm pretty sure.
Why do you want a full mesh top? I don't know about cresties, but for your BP it's so much easier to maintain humidity levels with a solid top. I bought RHP from ProHeat and they've amazing; so much better than the UTHs I've I had before. They are kind of pricey between the panels (I needed 2 for the size enclosure I got) and thermostat but imo worth every penny.
I'll check it out! Full mesh works much better with my preferred lighting setups- I don't like having them in the enclosure for safety and it makes arranging the UV/DHP combo much easier. I don't have issues keeping humidity up with full mesh the majority of the time, and when I have I just cover some of the top with glass or acrylic.
_________________________________________________________________________
0.0.1 Correlophus ciliatus "Aiko"
1.0.0 Python regius "Atticus"
"Those who teach the most about humanity, aren't always human." -Donald Hicks
-
-
Registered User
Re: Best brand of custom PVC caging?
 Originally Posted by asplundii
The best fully custom cage builder I have used is FocusCubed. They can build pretty much anything. Just be aware that you will have to pay a premium for the level of customization and also have a longer wait time
I will check them out! Not worried about money or time, that's why I'm planning a year in advance haha!
_________________________________________________________________________
0.0.1 Correlophus ciliatus "Aiko"
1.0.0 Python regius "Atticus"
"Those who teach the most about humanity, aren't always human." -Donald Hicks
-
The Following User Says Thank You to ahouseofscales For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|