Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 651

1 members and 650 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,116
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 5 of 5

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Patternless Traits

    Quote Originally Posted by nikkubus View Post
    scrub experience knows if it's a simple recessive.
    To the best of my knowledge it is recessive. That said, there are a handful of different scrub species so it may not hold true for all of them. Also, there are some animals that are not so much patternless as their pattern has simply faded away as they aged
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (06-08-2022),nikkubus (06-08-2022)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1