Future pairings, thoughts and discussion. (everyone)

[Albert Clark]

That's why I got the black pastel banana. I actually like the adult version better than the hatchling. It's one of the few bananas I've seen so far I like the adult better in. The purplish grey background with yellow spots is what I am hoping to get.

But nothing can beat a banana hatchling at impulse sales lol. Sadly most do know know that they change so much as they grow.

Are the albinos allylic with lavender albinos? The double hey may produce a visual. I know the candy is compatible with albino so I would think lavender albino would be also.

Sent from my SM-S767VL using Tapatalk

This is a great thread highlighting differences in albino and lavender albino. Allellic or not Allellic? Questions answered.

• Thread Tools
• Search Thread
• Display

• 06-09-2020, 03:01 PM
  #1
  
  Kingdomall
  
  Registered UserJoin Date06-07-2020Posts41Thanks0Thanked 14 Times in 8 Posts
  
  Albino and Lavender
  
  Hello there,
  I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
  Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
  If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
  Thanks.
  
  
  Last edited by Kingdomall; 06-09-2020 at 03:05 PM.
  
  
  
  
  Reply Reply With Quote
  Thanks Blog this Post
  
• 06-09-2020, 03:07 PM
  #2
  
  Stewart_Reptiles
  
  Telling it like it is! Join Date09-28-2006Posts24,840Thanks6,116Thanked 20,797 Times in 9,579 PostsBlog Entries1Images: 6
  
  Re: Albino and Lavender
  
  
  Originally Posted by Kingdomall
  Hello there,
  I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
  Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
  If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
  Thanks.
  
  
  
  They are not the same and are not compatible so if you were to breed Lavender to Albino you would get some Double Hets, by breeding those double hets you would have 1/16 chance to produce a Double Recessive however will it be different or easily idenfiable it not likely.
  
  
  Deborah Stewart
  
  SOCIAL MEDIA
  
  
  
  
  Reply Reply With Quote
  Thanks Blog this Post
  
• The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
  
  PartySnake13 (06-09-2020)
  
  
• 06-09-2020, 03:38 PM
  #3
  
  PartySnake13
  
  Registered UserJoin Date07-03-2019Posts98Thanks145Thanked 27 Times in 19 Posts
  
  Re: Albino and Lavender
  
  
  Originally Posted by Kingdomall
  Hello there,
  I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
  Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
  If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
  Thanks.
  
  
  
  
  There are numerous locations where a spontaneous mutation can occur, causing the disruption of one step in the melanin production process and resulting in an albino snake.
  The albino and lavender albino genes are located on different alleles, therefore if bred together the offspring will still have one working melanin production gene at both alleles.
  
  
  For example, Albino and Candy are located on the same allele, therefore breeding them together will produce an intermediate form of albinism known as a candino.
  
  
  When breeding an Albino to a Lavender Albino each parent passes on one copy of their different albino gene and one normal gene for the opposing form of albino.
  A lavender albino has 2 normal alleles for albino; an albino has 2 normal alleles for lavenderalbino.
  
  
  Producing visual/ double homologous lavender albino albinos would likely be an waste of time/ resources, only resulting in an albino looking animal with a possible pattern influence from the lavender trait, as the albino gene's inability to produce blue pigment would likely dominate the lavender albino genes colors, and at the end of the day there are much more rewarding double het projects.
  
  
  Last edited by PartySnake13; 06-09-2020 at 03:47 PM.
  
  
  
  
  Reply Reply With Quote
  Thanks Blog this Post
  
• 06-09-2020, 07:31 PM
  #4
  
  Kingdomall
  
  Registered UserJoin Date06-07-2020Posts41Thanks0Thanked 14 Times in 8 Posts
  
  Re: Albino and Lavender
  
  thank you for your responses, I appreciate it greatly
  
  
  
  
  
  
  Reply Reply With Quote
  Thanks Blog this Post
  
• The Following User Says Thank You to Kingdomall For This Useful Post:
  
  PartySnake13 (06-09-2020)
  
  
• 06-10-2020, 09:10 AM
  #5
  
  asplundii
  
  BPnet Veteran Join Date10-17-2008Posts901Thanks101Thanked 703 Times in 374 Posts
  
  Re: Albino and Lavender
  
  
  Originally Posted by PartySnake13
  The albino and lavender albino genes are located on different alleles, therefore if bred together the offspring will still have one working melanin production gene at both alleles.
  
  For example, Albino and Candy are located on the same allele, therefore breeding them together will produce an intermediate form of albinism known as a candino.
  
  
  
  As a point of clarification:
  
  Alleles are different versions of the same gene. So Albino and Candy are alleles which is why they are compatible and make the heteroallelic Candino
  
  Albino and Lav are two completely different, unrelated genes. Because of this, they are not alleles
  
  
  actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
  
  
  
  
  Reply Reply With Quote
  Thanks Blog this Post
  

+ Reply to Thread

Quick Navigation BP Morphs & Genetics Top

Your Message

Title:
[COLOR=#000000][FONT=Arial][TABLE="class: cke_editor, width: 673"]
[TR]
[TD="class: cke_top"] FontSize