Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 714

1 members and 713 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,230
Posts: 2,572,849
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Results 1 to 10 of 10
  1. #1
    Registered User
    Join Date
    06-26-2018
    Posts
    16
    Thanks
    5
    Thanked 19 Times in 7 Posts
    Images: 1

    Morph Market Question

    I decided to try purchasing a snake through Morph Market for the first time and so far it has gone very badly. I am not posting this to complain, but I would like to know if something similar has happened to anyone else and if I have any options moving forward?

    Summary of what happened.

    10/29/21 - I saw an Emerald Tree Boa for sale on Morph Market and contacted the seller by texting a cell phone number in his ad. I asked him if he would hold the snake for up to 4 weeks for me if I put down a deposit or paid in full. He agreed to hold him if I paid in full. I paid him $1,570.00 via Paypal.

    11/15/21 - Through text message we arranged a ship date of 11/18/21.

    11/18/21 - He confirmed that it shipped as planned.

    11/19/21 - The snake arrived but was dead on arrival. Seller reached out to me within minutes to confirm I had received the snake and I gave him the bad news. He told me that he would ship me another snake the following week and I requested a picture. He told me he would send me a picture soon.

    12/16-21 - I have had several text exchanges with the seller since 11/19/21 (as recently as 12/14/21. However, have not received a picture or ship date for the new snake. I tell him via text that I would like a refund minus the shipping costs. I did not receive a response.

    12/17/21 - I go on Morph Market to fill out a dispute form and find that the seller has deleted his account. I know it was still active on 12/14/21.

    I have the seller's full name, phone number, and address. I found his facebook pages (personal and business). I have screen shots of his Morph Market ad and I have all of our text messages. But I still have no idea what to do. I reached out to Morph Market a few minutes ago, but I don't know if there is anything they can do since he already deleted his account.

    I appreciate any feedback regarding this situation.

    Thank you,
    Brian

  2. The Following 2 Users Say Thank You to Bfrank For This Useful Post:

    Bogertophis (12-17-2021),Homebody (12-17-2021)

  3. #2
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,974
    Thanks
    29,663
    Thanked 20,768 Times in 12,431 Posts
    What a horrible experience! I've had zero dealings thru MM, so you'll have to wait for others to give input, but stuff like this is surely rare, or they (MM) wouldn't be in existence. What a sad & frustrating mess, & yes, I'd be angry & feel like I'd been scammed. Have you spoken to PayPal?
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  4. The Following User Says Thank You to Bogertophis For This Useful Post:

    nikkubus (12-20-2021)

  5. #3
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,604
    Thanks
    3,028
    Thanked 10,071 Times in 4,868 Posts
    Images: 34
    I think with PayPal G&S you only have so long to file a dispute so I would do it now (item not as described).

    Also, very few sellers ship critters this time of year due to the holiday crush (which is literal with some packages!), and depending on their location they may not ship again until spring due to the weather.

  6. The Following 4 Users Say Thank You to bcr229 For This Useful Post:

    Armiyana (12-17-2021),Bogertophis (12-17-2021),Homebody (12-17-2021),nikkubus (12-20-2021)

  7. #4
    BPnet Senior Member
    Join Date
    06-07-2018
    Posts
    1,075
    Thanks
    1,474
    Thanked 2,016 Times in 890 Posts
    Images: 7
    Do make sure to give MM all the information you have on the seller.
    I recently signed up as a seller and they required me to have a photo of myself with my ID, a separate photo of the ID and a photo of myself with some of my animal's habitats. At the very least they will hopefully keep the name on hand as a banned seller. Unfortunately that doesn't stop them from having someone else sign up as the account holder =/

    Regarding Paypal:
    Please tell me you paid via invoice or as a G&S. Do start contacting paypal regarding this now to file the dispute.
    If this person convinced you to pay by friends and family, then you are out of luck. Paypal will not file disputes on friend and family purchases.

  8. The Following 4 Users Say Thank You to Armiyana For This Useful Post:

    Alien (12-18-2021),bcr229 (12-17-2021),Bogertophis (12-17-2021),nikkubus (12-20-2021)

  9. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Have you contacted MM Customer Service directly? They may be able to help
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (12-20-2021),Erie_herps (12-22-2021),nikkubus (12-20-2021)

  11. #6
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Morph Market Question

    I would also be ok if you posted the info here to keep others here from having the same experience with the person in question. I have done business through MM with no issues. I don't buy from small sellers or a seller that only has one animal up for sale. That doesn't mean small sellers are not worthy but it is just my preference. There are a lot of small sellers out there who are worthy to do business with.

  12. The Following 2 Users Say Thank You to Skyrivers For This Useful Post:

    Bogertophis (12-20-2021),nikkubus (12-20-2021)

  13. #7
    BPnet Senior Member
    Join Date
    06-07-2018
    Posts
    1,075
    Thanks
    1,474
    Thanked 2,016 Times in 890 Posts
    Images: 7
    Ouch, Skydivers. Lol
    As a small seller who only had one snake up for sale.... That hurts.

    Also. Weird fact.
    Unless you're paying for a MM account, the free version only lets you sell up to 750$ in animals at any given time. So in my case, I was only able to put at most two listings up at a time. Hahah. I didn't want to drop the sub when I only had 3 animals to sell in at least a year.

    This also means that the breeder must have had a paid sub to MM in order to post a 1400$ animal or was doing a scammer looking listing already by having a low all price with the actual price in the desc or listing instead.
    Last edited by Armiyana; 12-20-2021 at 07:07 PM.

  14. The Following 4 Users Say Thank You to Armiyana For This Useful Post:

    Bogertophis (12-20-2021),Homebody (12-21-2021),nikkubus (12-20-2021),plateOfFlan (12-20-2021)

  15. #8
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,848 Times in 973 Posts
    I have not had an experience like that on MM, but I have elsewhere and it sucks. I didn't have luck filing a dispute with paypal, but I think there was a lot more time in between with my situation than yours so you still may be in the window. File a dispute immediately, it's worth a shot. It may be worth attempting to file with credit card company if paypal doesn't cover it and you happened to pay with a card and not bank account. I agree with others that it's worth reaching out to MM too.

    Sorry you had that happen :'(
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  16. The Following 2 Users Say Thank You to nikkubus For This Useful Post:

    Armiyana (12-20-2021),Bogertophis (12-20-2021)

  17. #9
    BPnet Senior Member
    Join Date
    06-07-2018
    Posts
    1,075
    Thanks
    1,474
    Thanked 2,016 Times in 890 Posts
    Images: 7
    Yeah. I purchased 5 animals through MM in the past 2 years and only one of them is a big name seller. The others were all private small business. All wonderful sellers and animals.
    My biggest red flags regardless of who the seller is, is if they say they accept Paypal friends and family or they don't 24hr guarantee on arrival. Sometimes shipping stress doesn't hit on arrival so those extra couple hours are important. Especially when 2 of my boxes (both from big name breeders. Lol) had gone missing in shipment for a day. As someone who has been using payments through PayPal for years.... Anyone using F&F is doing so to avoid taxes and fees. Which they should not be and can get them frozen if PayPal gets wise to it..

    The format is much better than just posting on a forum like it's craigslist.
    The sad truth of the matter is that there is only MM as a reliable marketplace for selling reptiles and more online in our hobby. But at the same time, you will see some scammers or less than friendly interactions from time to time.

  18. The Following 2 Users Say Thank You to Armiyana For This Useful Post:

    Bogertophis (12-23-2021),Homebody (12-21-2021)

  19. #10
    Registered User FIREBLADE's Avatar
    Join Date
    08-24-2012
    Location
    Washington State
    Posts
    49
    Thanks
    0
    Thanked 8 Times in 5 Posts
    Hopefully Paypal can help you I really like Morph market but with more popularity come scammers and low life's that is the sad part.
    I have had good luck with the site so far but my next purchase could be a bad one.
    I try to check out sellers but there is no fool proof method that I know off.
    I am making payments on 3 different snakes different sellers and I am hopping they all turn out good. But in your case like most have suggested Paypal or your credit card company may be your best option.
    Claudia

    Piebald ,Butter
    Spider, Mojave
    Bumblebee's
    Pastel , Hypo
    Blond Pastel, Lesser
    Het Pied, Black Pastel
    Albino, Pewter
    Het Albino
    Fire, Firefly

  20. The Following User Says Thank You to FIREBLADE For This Useful Post:

    Bogertophis (12-23-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1