Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 929

2 members and 927 guests
MichPlat, rlditmars,
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Search Forums

» Today's Birthdays

Lorri (51)

» Stats

Members: 75,945
Threads: 249,146
Posts: 2,572,377
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 10

Threaded View

  1. 12-20-2021, 09:38 AM #5
    asplundii
    asplundii is offline
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Have you contacted MM Customer Service directly? They may be able to help
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
    Reply With Quote Reply With Quote

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (12-20-2021),Erie_herps (12-22-2021),nikkubus (12-20-2021)
« Previous Thread | Next Thread »

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  

Forum Rules
Powered by vBadvanced CMPS v4.2.1