Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,080

1 members and 1,079 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,141
Posts: 2,572,339
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 11

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Question about Banana morph

    Quote Originally Posted by JJpeep View Post
    If you don't mind me asking, what makes the hatchlings difficult to identify?
    With both parents carrying Butter and YB you have fairly high odds of making all white snakes. The question becomes: Is the all white snake you produce just a simple SuperButter? Or is it a SuperButter Ivory Banana Pastel?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    JJpeep (09-28-2021),nikkubus (09-28-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1