» Site Navigation
1 members and 1,913 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
Question about Banana morph
Hello,
I have a question about the banana morph. So I know that they can be either male or female producers. I was looking for a male for my Pastel Butter Yellowbelly female. I really have been doing research into what kind of male I wanted to invest in. I really like the Pastel Cinnamon Butter males I have found. Recently I like a Banana Butter yellow belly. My question is, if I went for the Banana Butter Yellow Belly, would they pair only produce one sex even though there are other morphs involved? I honestly would t mind either way, but I am still curious to see how that would work.
-
-
So they would produce males and females, its just that they would mostly produce only one sex of bananas and banana combos. Non banana would usually be the opposite sex. Banana does hop chromosomes, so every now and again you might get a banana of the opposite sex.
Banana Butter YB x Pastel Butter YB may give you some tough to identify hatchlings but genetically they should be: https://www.worldofballpythons.com/w...emale=34,32,20
I put a link to wizard instead of typing it out because it's a long list.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following User Says Thank You to nikkubus For This Useful Post:
-
Registered User
Re: Question about Banana morph
Ahhh, okay. That helps. I actually have been using the calculator you linked. Just to see what kind of possible outcomes I could have with her. Typing in different males. I wasn't looking at a banana combo at first but I saw a nice male around her age. So he was in consideration. Then I thought of the whole banana thing and was curious as to how that plays out. Thanks for your insight.
-
-
Registered User
Re: Question about Banana morph
 Originally Posted by nikkubus
So they would produce males and females, its just that they would mostly produce only one sex of bananas and banana combos. Non banana would usually be the opposite sex. Banana does hop chromosomes, so every now and again you might get a banana of the opposite sex.
Banana Butter YB x Pastel Butter YB may give you some tough to identify hatchlings but genetically they should be: https://www.worldofballpythons.com/w...emale=34,32,20
I put a link to wizard instead of typing it out because it's a long list.
If you don't mind me asking, what makes the hatchlings difficult to identify? Would it be a bad decision if I went with banana gene male?
-
-
Registered User
The male I am looking at is a Banana Cinnamon Butter, BTW. I forgot to add the cinnamon I think. LOL, sounds like I am talking about a recipe 😂
-
-
Re: Question about Banana morph
 Originally Posted by JJpeep
If you don't mind me asking, what makes the hatchlings difficult to identify?
With both parents carrying Butter and YB you have fairly high odds of making all white snakes. The question becomes: Is the all white snake you produce just a simple SuperButter? Or is it a SuperButter Ivory Banana Pastel?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
JJpeep (09-28-2021),nikkubus (09-28-2021)
-
Registered User
Re: Question about Banana morph
Oh I see! Understood! Thank You.
-
-
Re: Question about Banana morph
 Originally Posted by asplundii
With both parents carrying Butter and YB you have fairly high odds of making all white snakes. The question becomes: Is the all white snake you produce just a simple SuperButter? Or is it a SuperButter Ivory Banana Pastel?
Exactly. Even the Ivories, does it have a single copy of Butter, Banana, or Pastel? Who knows.
Now if you are getting a Banana Cinnamon Butter (no YB), which imho is a much better mate than Banana Butter YB, you will still have that problem with Super Butter, but Cinnamon is going to be a lot easier to identify than YB in Banana or single Butters. YB can be tough to ID in anything from BEL complex because of how BEL complex messes with lower side pattern. You also won't have any Ivory, so your Supers that are tough to ID get cut in half.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
-
Registered User
Re: Question about Banana morph
Thank you both for your input. I have been in talks with a breeder this week. For the past couple of weeks I have been going back and forth in my mind about a Banana Cinnamon Butter. I really like him. So I talked to the breeder yesterday and I think I will be ordering him next week. I live his pattern and I really wanted to breed him to my Pastel Butter Yellow Belly. It actually will be my first time breeding snakes. So I wanted to get something I really like. Both snakes have a tannish hue and the pattern colors are light brown. I checked the morph calculator and it looks like a have a couple possibilities for hatchlings. So I am excited to prepare this year for possibly next season breeding. All of your input has really helped. Thank you again.
-
-
If this is your first time breeding I would shy away from Banana Butter YB x Pastel Butter YB those hatchlings would be very difficult to identify going with cinnamon instead of YB would be a better way to go. Banana Cinnys are beautiful, I have one in my collection
"I'd rather be hated for who I am, than loved for who I am not" -Kurt Cobain
-
The Following User Says Thank You to Snow Balls For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|