Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 828

0 members and 828 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,908
Threads: 249,108
Posts: 2,572,133
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 10 of 13

Threaded View

  1. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    This article makes the rounds in FB groups frequently. If you research the backgrounds of the authors you will discover they are highly intertwined with animal-rights groups, specifically PETA, which is the source of at least two of the pictures in the article.

    That being the case, it is small wonder that they would conclude that we are keeping our animals wrong. Anything to discredit us is going to be in their favour. The real bothersome thing is that people in the community keep latching onto it, thereby bedding down with the devil
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (08-12-2021),Bogertophis (08-12-2021),jmcrook (08-12-2021),Snagrio (08-12-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1