Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,619

0 members and 1,619 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,073
Threads: 249,220
Posts: 2,572,811
Top Poster: JLC (31,651)
Welcome to our newest member, LeonoraOrdonez5
Page 1 of 2 12 LastLast
Results 1 to 10 of 13
  1. #1
    Registered User
    Join Date
    07-13-2018
    Posts
    19
    Thanks
    1
    Thanked 4 Times in 1 Post

    Question Are we keeping our snakes improperly, a study on snake housing.

    I don't remember seeing this posted here before, but it seems particularly relevant to keepers of large pythons. Here is a published study looking at the captive housing of snakes and it doesn't look so good for us. The study suggest that we as reptile keepers should have much larger enclosures for our snakes than nearly anyone provides. For the vast majority of people the recommendations would be nearly, if not totally, impossible for the larger species such as burmese, amesthystine and reticulated pythons. I doubt most of us would say larger enclosures are bad but is the significance as great as a cursury read of the study implies? Thoughts on the matter?

    Link to the study.
    https://www.sciencedirect.com/scienc...58787818302211

  2. The Following 4 Users Say Thank You to TheSandlapper For This Useful Post:

    Bogertophis (08-08-2021),Caitlin (09-29-2021),GoingPostal (08-09-2021),TofuTofuTofu (08-08-2021)

  3. #2
    BPnet Senior Member Snagrio's Avatar
    Join Date
    08-11-2020
    Posts
    1,031
    Thanks
    188
    Thanked 1,355 Times in 588 Posts
    So, going by the short of the article that snakes should be in enclosures where they can fully stretch in a straight line, the overriding majority of owners both aren't and reasonably can't provide such housing for anything the size of, say, a full-grown boa constrictor upwards. Not only would such an enclosure be incredibly expensive, but fitting an 8 foot+ enclosure (let alone the 15-20 feet of the giants) would be a tall if not impossible order for many dwellings due to sheer space logistics.

  4. #3
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,960
    Thanks
    29,650
    Thanked 20,754 Times in 12,421 Posts
    I would agree that many or most "enclosures" fall short of what is optimal for keeping snakes. I think we all need to work on that- even if that puts many of them "off the table" as pets.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  5. The Following 6 Users Say Thank You to Bogertophis For This Useful Post:

    Caitlin (09-29-2021),GoingPostal (08-09-2021),Hugsplox (08-09-2021),Serpentes75 (08-08-2021),Team Slytherin (12-01-2021),TofuTofuTofu (08-08-2021)

  6. #4
    Registered User Serpentes75's Avatar
    Join Date
    07-29-2021
    Location
    Maryland
    Posts
    11
    Thanks
    8
    Thanked 9 Times in 4 Posts

    Re: Are we keeping our snakes improperly, a study on snake housing.

    Quote Originally Posted by Snagrio View Post
    So, going by the short of the article that snakes should be in enclosures where they can fully stretch in a straight line, the overriding majority of owners both aren't and reasonably can't provide such housing for anything the size of, say, a full-grown boa constrictor upwards. Not only would such an enclosure be incredibly expensive, but fitting an 8 foot+ enclosure (let alone the 15-20 feet of the giants) would be a tall if not impossible order for many dwellings due to sheer space logistics.
    While it may be difficult to provide a "full length" enclosure for some of the largest of pythons, it's not difficult or unreasonable to provide that for a full-grown boa constrictor in most cases. Alot of boas never exceed the 5 to 7ft range. You might get a few 8ft+ females sometimes. Larger than that is quite rare, if not unrealistic. People usually think of the largest possible snake sizes, when most never reach those sizes (like the 20ft number you mentioned).

  7. #5
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,848 Times in 973 Posts
    Not a very good study. There are too many different species being used, an extremely small sample size, and no controls to speak of. The only measure being taken is if allowed, the snakes will straighten out or try to, not that it is of any benefit to them. Then it has the audacity to call everything we believe in the hobby "folklore"/"mythology" without any evidence, when some things might be, but many are tried and true across sample size far greater than what was used in the study. This is not how science works.

    It think some species really do need more space than the avg keeper gives them to be healthy, but I am basing this on measurable evidence, not just wild assumption. We can look at obesity for example, and notice that some species of giant snakes (like retics) kept in small enclosures tend to either be obese, or have low muscle percentage compared with animals who are given more space. Ability to climb is another factor in obesity in retics we need to consider, because they really do love to climb. When the animal is being negatively effected by the enclosure size, there is clear evidence that we are sacrificing their wellbeing for money/space savings. Oftentimes these giant snakes aren't even given LxW>=length of the snake like we give others, despite them being a pretty active species if allowed. Time outside the enclosure should be taken into account as well. If a keeper does not have time to supervise their animal exercising outside the enclosure on a regular basis, the animal is going to need more room inside the enclosure.

    IMHO any study that attempts to combine every single species of snake is going to be seriously faulty because the needs vary between species drastically. Breeders may have biased, but at least they have a large sample size of a single species to gather information.
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  8. The Following 8 Users Say Thank You to nikkubus For This Useful Post:

    Bogertophis (08-08-2021),EL-Ziggy (08-10-2021),Hugsplox (08-09-2021),jmcrook (08-08-2021),Serpentes75 (08-08-2021),Snagrio (08-08-2021),Spicey (08-10-2021),tegu (08-10-2021)

  9. #6
    BPnet Senior Member Snagrio's Avatar
    Join Date
    08-11-2020
    Posts
    1,031
    Thanks
    188
    Thanked 1,355 Times in 588 Posts

    Re: Are we keeping our snakes improperly, a study on snake housing.

    Quote Originally Posted by nikkubus View Post
    Not a very good study. There are too many different species being used, an extremely small sample size, and no controls to speak of. The only measure being taken is if allowed, the snakes will straighten out or try to, not that it is of any benefit to them. Then it has the audacity to call everything we believe in the hobby "folklore"/"mythology" without any evidence, when some things might be, but many are tried and true across sample size far greater than what was used in the study. This is not how science works.

    It think some species really do need more space than the avg keeper gives them to be healthy, but I am basing this on measurable evidence, not just wild assumption. We can look at obesity for example, and notice that some species of giant snakes (like retics) kept in small enclosures tend to either be obese, or have low muscle percentage compared with animals who are given more space. Ability to climb is another factor in obesity in retics we need to consider, because they really do love to climb. When the animal is being negatively effected by the enclosure size, there is clear evidence that we are sacrificing their wellbeing for money/space savings. Oftentimes these giant snakes aren't even given LxW>=length of the snake like we give others, despite them being a pretty active species if allowed. Time outside the enclosure should be taken into account as well. If a keeper does not have time to supervise their animal exercising outside the enclosure on a regular basis, the animal is going to need more room inside the enclosure.

    IMHO any study that attempts to combine every single species of snake is going to be seriously faulty because the needs vary between species drastically. Breeders may have biased, but at least they have a large sample size of a single species to gather information.
    Also REALLY didn't like the little quip about how "the government should step in and mandate regulations" because we have enough of that garbage going on in the reptile hobby as it is, but that's a whole 'nother can of worms. I think the common rule of "enough size for a snake to fully extend itself in two directions" is adequate personally, but there can always be exceptions on a species or even individual basis.

    If anything, I'm more interested in the study of enrichment that was barely touched upon in the article. How much value do snakes place on environmental enrichment? If and how does it vary between species (notably sedentary vs more active groups)? What do snakes consider as enrichment and how does it differentiate among species (not only sedentary vs active but also burrowing/terrestrial vs semi/fully arboreal)?

  10. The Following User Says Thank You to Snagrio For This Useful Post:

    nikkubus (08-12-2021)

  11. #7
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Are we keeping our snakes improperly, a study on snake housing.

    Quote Originally Posted by Snagrio View Post
    Also REALLY didn't like the little quip about how "the government should step in and mandate regulations" because we have enough of that garbage going on in the reptile hobby as it is, but that's a whole 'nother can of worms. I think the common rule of "enough size for a snake to fully extend itself in two directions" is adequate personally, but there can always be exceptions on a species or even individual basis.

    If anything, I'm more interested in the study of enrichment that was barely touched upon in the article. How much value do snakes place on environmental enrichment? If and how does it vary between species (notably sedentary vs more active groups)? What do snakes consider as enrichment and how does it differentiate among species (not only sedentary vs active but also burrowing/terrestrial vs semi/fully arboreal)?
    I agree. Herp fans and keepers suffer enough from government regulations. More regulations equals less people who can enjoy the ownership of animals because of the licensing that would grow in price as the regulations do. The answer is simple. Be responsible to the animals you care for. I always tried to give my animals as much room and as natural as possible but it is difficult to provide a space that is large enough for a 15-20+ Ft snake. In the wild they have a territory and they have a way of life that would prove almost impossible without a zoo quality enclosure. We do need to keep in mind that they think and adapt to what is available. Sure my experience is some what limited. My Rainbow was 18ft at age 6 and I often wished her 8ft X 4ft X 4ft cage was larger. It did however have a cave with proper heat, A warm swimming area large enough to get all the way in and submerge when she so desired and she was also allowed time to roam the living room under controlled conditions. Was this adequate? She seamed to enjoy her enclosure. She would go back to it once she was done roaming the living room and curl up after having some time to explore. Keep in mind she was pet quality from birth and was also used for educational shows. We (herp) owners all do our best. Should we? That is a moral issue and I feel we all have to answer that on a personal level.

    I agree the article is limited in sample size and the way it was presented seamed bias.

  12. The Following User Says Thank You to Skyrivers For This Useful Post:

    nikkubus (08-12-2021)

  13. #8
    BPnet Royalty EL-Ziggy's Avatar
    Join Date
    11-05-2014
    Location
    GA
    Posts
    4,224
    Thanks
    5,091
    Thanked 5,533 Times in 2,710 Posts

    Re: Are we keeping our snakes improperly, a study on snake housing.

    According to those parameters a lot of us aren’t keeping our animals properly. I won’t be able to provide 10’ enclosures for my scrub and olive but I’m working on their 8 footers. Hopefully they’ll be here by years end.
    3.0 Carpet Pythons, 1.1 Bullsnakes
    1.0 Olive Python 1.0 Scrub Python,
    1.0 BI, 0.1 BCO

  14. The Following 3 Users Say Thank You to EL-Ziggy For This Useful Post:

    Bogertophis (09-29-2021),Gio (08-11-2021),nikkubus (08-12-2021)

  15. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    This article makes the rounds in FB groups frequently. If you research the backgrounds of the authors you will discover they are highly intertwined with animal-rights groups, specifically PETA, which is the source of at least two of the pictures in the article.

    That being the case, it is small wonder that they would conclude that we are keeping our animals wrong. Anything to discredit us is going to be in their favour. The real bothersome thing is that people in the community keep latching onto it, thereby bedding down with the devil
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  16. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (08-12-2021),Bogertophis (08-12-2021),jmcrook (08-12-2021),Snagrio (08-12-2021)

  17. #10
    BPnet Senior Member Snagrio's Avatar
    Join Date
    08-11-2020
    Posts
    1,031
    Thanks
    188
    Thanked 1,355 Times in 588 Posts

    Re: Are we keeping our snakes improperly, a study on snake housing.

    Quote Originally Posted by asplundii View Post
    This article makes the rounds in FB groups frequently. If you research the backgrounds of the authors you will discover they are highly intertwined with animal-rights groups, specifically PETA, which is the source of at least two of the pictures in the article.

    That being the case, it is small wonder that they would conclude that we are keeping our animals wrong. Anything to discredit us is going to be in their favour. The real bothersome thing is that people in the community keep latching onto it, thereby bedding down with the devil
    PETA.

    Well, now I know where to put that whole article.

  18. The Following 2 Users Say Thank You to Snagrio For This Useful Post:

    Armiyana (09-28-2021),asplundii (08-13-2021)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1