» Site Navigation
0 members and 569 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,066
Threads: 249,217
Posts: 2,572,779
Top Poster: JLC (31,651)
|
-
Registered User
100% Het pied x Visual albino
Ok so ive started doing my research into genetics morphs and breeding and all that comes with those topics as i definitely want to breed one day especially with the two bps i have right now. as of right now ive been able to find nothing online about this pairing So with that in mind i currently have a female enchi 100% het pied, and a male visual albino. if i were to breed them together one day, would i have any odds at getting a double het(pied and albino) or would all the hatchlings be a mix of het pied and het albino? Or would i first need to have another het pied to breed with my female to produce a visual pied that i would then have to breed to the albino to produce the double hets? Any other great breeding genetic advice is also greatly appreciated, i want to learn and absorb all i can before i even consider breeding them.
-
The Following User Says Thank You to JustASamsquanch For This Useful Post:
-
Re: 100% Het pied x Visual albino
 Originally Posted by JustASamsquanch
Ok so ive started doing my research into genetics morphs and breeding and all that comes with those topics as i definitely want to breed one day especially with the two bps i have right now. as of right now ive been able to find nothing online about this pairing So with that in mind i currently have a female enchi 100% het pied, and a male visual albino. if i were to breed them together one day, would i have any odds at getting a double het(pied and albino) or would all the hatchlings be a mix of het pied and het albino? Or would i first need to have another het pied to breed with my female to produce a visual pied that i would then have to breed to the albino to produce the double hets? Any other great breeding genetic advice is also greatly appreciated, i want to learn and absorb all i can before i even consider breeding them. 
You'd get some enchi, some normal, all het albino, and all 50% chance of het pied. In order to get any visual recessives both parents at minimum need to both be 100% het, 100% het x Visual, or Visual x Visual.
https://www.reptilesmagazine.com/a-c...tile-genetics/
Last edited by jmcrook; 07-29-2021 at 04:28 PM.
-
The Following User Says Thank You to jmcrook For This Useful Post:
-
I would not recommended breeding those two together as a new breeder. Double recessives are really difficult to hit the odds, and you will have a lot of normals and hets that are really tough to sell. Instead I would try to look at some combos that involve those separately that don't include other recessives, and pick one combo to work towards first, choosing a new mate for whichever of them carefully.
Albinos for the amount of work of recessives, don't sell the best. However, Albino and Candy are allelic, meaning you can breed an Albino to a Candy, and get Candino, which sell better. Your best bet with breeding him is to find a couple females that are het candy with some other morph(s). Enchi, anything in the YB complex, and Orange Dream are all morphs that will greatly enhance the brightness of colors in Albino/Candy/Candino. You can look at certain morphs that change pattern and some of those complement them nicely, such as GHI, Leopard, and Spider.
So as an example:
Your Albino male x Enchi GHI het Candy could give you with equal odds
-Enchi GHI Candino
-Enchi Candino
-GHI Candino
-Candino
-Enchi GHI het Albino
-Enchi het Albino
-GHI het Albino
-Normal het Albino
Only 1/8 being normal looking means much better chance to sell hatchlings easily. Yes, you may have to spend ~$500 on a female, but the price you can sell babies for dramatically increase as well.
As far as what to pair with your female, you should keep in mind that Enchi drastically reduces the amount of white in Pieds. Males are where I would put a lot more of my investment to get expensive animals, because you can pair the same expensive male to multiple cheap females and get good profit margins if you do it smart. I would be looking for a male visual Pied that also has another incomplete dominant morph or two. I would spend more time saving and thinking about what you rally want to works towards on this purchase, as visual Pied combos are pricy. Breeding het to het, you are going to get a lot of Normal 66% het Pied, which will be extremely difficult to sell, so you do not want to skimp on this purchase. You can always ignore the "het Pied" part of her and just breed her as an Enchi to a non-pied male that has great complementary incomplete dominant morphs, and there are some really cool powerhouse combo males you could pick up for ~$500 if you don't care about Pied, or even if you want to work on something else as you save up for a nice Pied male.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following User Says Thank You to nikkubus For This Useful Post:
-
Re: 100% Het pied x Visual albino
 Originally Posted by JustASamsquanch
as of right now ive been able to find nothing online about this pairing
Go to MorphMarket, enter the ball python section, at the top there is a 'Calculator' button. Click on that and you can enter any combination of parents in there (up to six genes each) and it will spit out the possible results
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: 100% Het pied x Visual albino
Thanks for the tips and info, so my main goal that i want to be able to breed towards is albino pieds, cuz they are pretty pricey from what ive found. So if i were to want to breed to that point with just my female (ignoring my male albino at the moment since albinos dont sell well.) i would basically want to get a visual pied male to breed with her to make more normal/enchi pieds, and then from there start working towards adding the albino gene later on once ive gotten better at just breeding with the pied morth alone? Again thanks for the help and info, i dont want to be one of those people that choose to start something like this before being 100% really ready.
-
-
Re: 100% Het pied x Visual albino
 Originally Posted by JustASamsquanch
i want to be able to breed towards is albino pieds, cuz they are pretty pricey
If making money is the main driver here, I would totally abandon the idea of albino pied at all. You need to realize you will lose money for many, many years before you start to turn a profit when you are working with recessives, and for every additional recessive, the difficult and time required to turn profit goes up exponentially.
If instead you focus on incomplete dominants that are in high demand, you will get a much faster turn around, as well as being able to progress in your projects more quickly. The only reason I would ever choose to breed a recessive on purpose is because I had an attachment to that particular morph, loved it, and didn't care it was going to be a money suck for a long time. While there are exceptions to the rule, and you can make money quickly starting with two double recessives bred together (big initial investment), there is still way better investments to be had in popular incomplete dominants.
One thing you want to keep in mind is the market fluctuates and follows certain patterns. When a brand new morph comes out, or an older morph falls back into favor because a big breeder produced a really cool combo with it, the price tag is really high for a while, but it drops off over time. The more animals you have at your disposal, the more you can try to breed the right things at the right times and try to max your profit, but when you are starting off, you want to try and chose something that has a pretty stable price point and is easy to make. This means watching the market over long periods of time and seeing what is going on.
What is visually appealing to you should always be a factor, even when money is the main factor, because your level of passion for the project is going to show in your lines. You can't breed the same pair over and over again every year, and make good money. You have to always be striving to create something new and interesting. Really take some time to get to know what's out there and get a feel for what you are passionate about. I would shop with a breeder like Olympus Reptiles or JKR before any random breeder because I know that when they are selecting holdbacks, they are looking at more than just which morphs the animal has. They are looking for the best representations of those morphs for the particular projects they work on, and their lines only get better and better, throwing the best of hatchlings. Guys like this can sell just about anything for a higher markup than anyone else, even when the market is oversaturated with underpriced animals because people know their animals are top notch.
If you go to https://www.morphmarket.com/us/c/rep...-pythons/index there are some things here to look for that can be really useful. Notice the color key, anything in blue is an incomplete dominant with one copy of the gene, purple is incomplete dominant with two copies of the gene. These should be the bread and butter for a new breeder to work with. The other thing to pay attention to is the numbers. Really low numbers usually indicate the morph is so rare or new that it isn't a good investment. Very large numbers usually indicate there are so many of this morph that aren't selling fast enough that it's a bad investment. You have to adjust for trends and how combos factor in, but this is a good general rule.
Hope that insight helps you. I watch a lot of new breeders crash and burn because they overlooked some of these things. Kudos for asking questions and making an effort to do your research before throwing them together.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following User Says Thank You to nikkubus For This Useful Post:
-
100% Het pied x Visual albino
 Originally Posted by nikkubus
If making money is the main driver here, I would totally abandon the idea of albino pied at all. You need to realize you will lose money for many, many years before you start to turn a profit when you are working with recessives, and for every additional recessive, the difficult and time required to turn profit goes up exponentially.
If instead you focus on incomplete dominants that are in high demand, you will get a much faster turn around, as well as being able to progress in your projects more quickly. The only reason I would ever choose to breed a recessive on purpose is because I had an attachment to that particular morph, loved it, and didn't care it was going to be a money suck for a long time. While there are exceptions to the rule, and you can make money quickly starting with two double recessives bred together (big initial investment), there is still way better investments to be had in popular incomplete dominants.
One thing you want to keep in mind is the market fluctuates and follows certain patterns. When a brand new morph comes out, or an older morph falls back into favor because a big breeder produced a really cool combo with it, the price tag is really high for a while, but it drops off over time. The more animals you have at your disposal, the more you can try to breed the right things at the right times and try to max your profit, but when you are starting off, you want to try and chose something that has a pretty stable price point and is easy to make. This means watching the market over long periods of time and seeing what is going on.
What is visually appealing to you should always be a factor, even when money is the main factor, because your level of passion for the project is going to show in your lines. You can't breed the same pair over and over again every year, and make good money. You have to always be striving to create something new and interesting. Really take some time to get to know what's out there and get a feel for what you are passionate about. I would shop with a breeder like Olympus Reptiles or JKR before any random breeder because I know that when they are selecting holdbacks, they are looking at more than just which morphs the animal has. They are looking for the best representations of those morphs for the particular projects they work on, and their lines only get better and better, throwing the best of hatchlings. Guys like this can sell just about anything for a higher markup than anyone else, even when the market is oversaturated with underpriced animals because people know their animals are top notch.
If you go to https://www.morphmarket.com/us/c/rep...-pythons/index there are some things here to look for that can be really useful. Notice the color key, anything in blue is an incomplete dominant with one copy of the gene, purple is incomplete dominant with two copies of the gene. These should be the bread and butter for a new breeder to work with. The other thing to pay attention to is the numbers. Really low numbers usually indicate the morph is so rare or new that it isn't a good investment. Very large numbers usually indicate there are so many of this morph that aren't selling fast enough that it's a bad investment. You have to adjust for trends and how combos factor in, but this is a good general rule.
Hope that insight helps you. I watch a lot of new breeders crash and burn because they overlooked some of these things. Kudos for asking questions and making an effort to do your research before throwing them together.
X2 on this. Starting a recessive project is hard unless you do it right. It takes a long time especially with double recessives. It takes years to turn profit so if you’re prepared for that then go for it but if not invest in 2, 3 gene animals and breed them. You’ll get odds and be able to turn a profit better
Sent from my iPhone using Tapatalk
Last edited by Snow Balls; 08-01-2021 at 12:21 AM.
"I'd rather be hated for who I am, than loved for who I am not" -Kurt Cobain
-
The Following User Says Thank You to Snow Balls For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|