Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 745

1 members and 744 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,103
Posts: 2,572,095
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 7 of 7
  1. #1
    BPnet Veteran Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    744
    Thanks
    482
    Thanked 991 Times in 475 Posts

    You need to register your reptiles and amphibians in Virginia

    I saw this article this morning, It was news to me.

    https://www.wfxrtv.com/news/outdoors...s-in-virginia/

    Calling all lizard, turtle, snake, and other reptilian or amphibious critter lovers! The Virginia Reptile and Amphibian Registry is now open for Virginians in possession of these species.

    According to the Virginia Department of Wildlife Resources (DWR), this registry is only for people living in Virginia with a Virginia native or naturalized species of reptile or amphibian that is currently in your private care — whether is was caught in the wild, captive-bred, or obtained outside Virginia — before July 1, 2021.

    However, Cornsnake morphs (ghost, snow, fancy, and other nonnative variations) and albino animals reportedly do not need to be registered.


    Well at least that lets Sicle off the registry (for now). All the rest of the crew are Non Native so they are good to go.

  2. The Following 2 Users Say Thank You to Gocntry For This Useful Post:

    Bogertophis (07-17-2021),nikkubus (07-19-2021)

  3. #2
    BPnet Royalty KMG's Avatar
    Join Date
    06-09-2012
    Location
    Tx
    Posts
    5,633
    Thanks
    1,032
    Thanked 2,944 Times in 1,958 Posts
    Images: 55
    Threatening an inability to get vet care is dirty. Them just trying to force people into something using feelings. Those that have been doing things correctly will comply while those that haven't will not. That's the problem with registrations. Only the good folks make the list. Then when they decide you can no longer have the registered item, or want you to now pay for it, they know which doors to knock on.
    Last edited by Bogertophis; 07-17-2021 at 02:40 PM. Reason: Leave your politics elsewhere.
    KMG
    0.1 BP 1.1 Blood Python 1.0 Brazilian Rainbow Boa 1.0 Aru Green Tree Python
    0.1 Emerald Tree Boa 0.1 Dumeril Boa 0.1 Carpet Python 0.1 Central American Boa
    0.1 Brooks Kingsnake 0.1 Speckled Kingsnake 1.0 Western Hognose
    0.1 Blonde Madagascar Hognose 1.0 Columbian Boa

    1.1 Olde English Bulldogge 1.0 Pit Bull

  4. The Following User Says Thank You to KMG For This Useful Post:

    nikkubus (07-19-2021)

  5. #3
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,783
    Thanks
    29,339
    Thanked 20,555 Times in 12,281 Posts
    Another way to look at it is they're protecting native species from over-collection (illegal poaching!).

    As human populations expand (along with the negative "side effects" such as pollution & pets running loose that kill wildlife) & the natural habitat for wildlife disappears, most of us want to make sure that our native species are not decimated by human greed or general thoughtlessness. This registry is just a way to establish one's long-term pets, so they're not confused with illegally-taken animals. Personally, I applaud their conservation efforts.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  6. #4
    BPnet Royalty KMG's Avatar
    Join Date
    06-09-2012
    Location
    Tx
    Posts
    5,633
    Thanks
    1,032
    Thanked 2,944 Times in 1,958 Posts
    Images: 55

    Re: You need to register your reptiles and amphibians in Virginia

    Quote Originally Posted by Bogertophis View Post
    Another way to look at it is they're protecting native species from over-collection (illegal poaching!).

    As human populations expand (along with the negative "side effects" such as pollution & pets running loose that kill wildlife) & the natural habitat for wildlife disappears, most of us want to make sure that our native species are not decimated by human greed or general thoughtlessness. This registry is just a way to establish one's long-term pets, so they're not confused with illegally-taken animals. Personally, I applaud their conservation efforts.
    On second thought just delete my entire post as it is all "political." I have no desire to go round and round with you........again.
    Last edited by KMG; 07-17-2021 at 03:05 PM.
    KMG
    0.1 BP 1.1 Blood Python 1.0 Brazilian Rainbow Boa 1.0 Aru Green Tree Python
    0.1 Emerald Tree Boa 0.1 Dumeril Boa 0.1 Carpet Python 0.1 Central American Boa
    0.1 Brooks Kingsnake 0.1 Speckled Kingsnake 1.0 Western Hognose
    0.1 Blonde Madagascar Hognose 1.0 Columbian Boa

    1.1 Olde English Bulldogge 1.0 Pit Bull

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    This is not new information. I moved to the region over a decade ago an,d when I called F&W before moving to find out the regs so that I would be in compliance, I was told about this
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #6
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,567
    Thanks
    2,968
    Thanked 9,997 Times in 4,836 Posts
    Images: 34

    Re: You need to register your reptiles and amphibians in Virginia

    Quote Originally Posted by asplundii View Post
    This is not new information. I moved to the region over a decade ago an,d when I called F&W before moving to find out the regs so that I would be in compliance, I was told about this
    It's new because the registry is closing for good at the end of this year. It looks like VA will prohibit keeping of native species acquired after July 1, 2021 as a measure to combat poaching.

  9. The Following 2 Users Say Thank You to bcr229 For This Useful Post:

    Hugsplox (07-19-2021),nikkubus (07-19-2021)

  10. #7
    BPnet Veteran Gocntry's Avatar
    Join Date
    05-28-2019
    Location
    Northern Va.
    Posts
    744
    Thanks
    482
    Thanked 991 Times in 475 Posts

    Re: You need to register your reptiles and amphibians in Virginia

    Quote Originally Posted by bcr229 View Post
    It's new because the registry is closing for good at the end of this year. It looks like VA will prohibit keeping of native species acquired after July 1, 2021 as a measure to combat poaching.
    Yep, new law as of July 01 2021,

    https://www.nbc12.com/2021/07/01/ban...fect-virginia/

    Generations of Virginians have taken box turtles from forests and yards to keep as pets. As of today, that’s illegal.

    Experts say the docile, colorful turtles are in decline, and new state regulations taking effect ban turning them into pets. The rules also impose tough restrictions on keeping common native reptiles and amphibians such as garter snakes and bullfrogs.


    The ban on pet box turtles is part of a larger effort by the wildlife department to better protect Virginia’s reptiles and amphibians.
    Another rule slashes the number of common native reptiles and amphibians that people can keep as pets. Previously, you could keep up to five of most species — for example, five garter snakes, plus five bullfrogs, and so on. The new rules cut that to one — literally one animal, not one of each species — per household.

  11. The Following User Says Thank You to Gocntry For This Useful Post:

    nikkubus (07-19-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1