Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 643

1 members and 642 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,110
Posts: 2,572,153
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 10 of 22

Threaded View

  1. #14
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Nidovirus is not an automatic death sentence. This narrative is solely down to the fact that the ability to test for the virus is stupidly easy but our actual knowledge of the virus and its behaviour/pathology/prevalence is pretty hazy.


    https://youtu.be/EU4iJMdD6Tw
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Albert Clark (08-30-2022),Bogertophis (05-24-2021),Malum Argenteum (09-01-2022)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1