Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 783

0 members and 783 guests
No Members online
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.

» Today's Birthdays

None

» Stats

Members: 75,887
Threads: 249,087
Posts: 2,572,042
Top Poster: JLC (31,651)
Welcome to our newest member, Saexs
Results 1 to 9 of 9

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I use Links to some extent or other for most of the species in my collection. I do not do it for the balls because most of them are not interested (I have four that will eat anything but the others only do rodents). The Dumeril also refuses to eat them. I have not tried them on the Calabar as they are imports and my primary goal with them is consistently feeding before they come out of quarantine, once they come out of Q I may try but their manner of feeding will likely mean links are not suitable.

    Species I feed:

    Oligodon purpurascens - microlinks; iguana, frog, quail, guinea fowl
    Rhamphiophis oxyrhynchus and R. rostratus - minilinks; iguana, frog, quail, guinea fowl
    Bredli - regular links, any size up to 50g; cycling between ones with fruit/veggie mixed in, egg mixed in, or roaches mixed in
    Blackhead - 100g links; cycling between ones with fruit/veggie mixed in, egg mixed in, or roaches mixed in
    Chondro - regular links, any size up to 25g; quail and guinea fowl
    alterna - minilinks; iguana, frog, quail, guinea fowl
    Hognose - microlinks; iguana, frog, quail, guinea fowl
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (03-29-2021),Caitlin (03-29-2021),dakski (03-29-2021),WrongPython (03-29-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1