Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 765

1 members and 764 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,100
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 9 of 9

Threaded View

  1. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Leopard Acid Fire Het Clown

    Quote Originally Posted by Cloud9morphs View Post
    can't way to see how it reacts with clown.
    Clown Acid BlkPastel, Clown Acid, Clown Acid Pin, and Clown Acid BlkPewter have all been made. They are all pretty interesting

    JKR has made a number of Clown Confusion combos as well
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    nikkubus (03-03-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1