Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,427

1 members and 1,426 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 14

Threaded View

  1. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Grey Banded Kingsnake

    Quote Originally Posted by Bogertophis View Post
    I've heard their temperaments tend to be mellower than most other king snakes.
    This is quite true. They are one of the most laid back species I have. Only ever taken a single bite and that was my fault for handling after eating crab and I guess the smell was enough to trigger a feed response.



    Quote Originally Posted by nikkubus View Post
    Very gorgeous. I haven't seen many around either.
    That is mostly down to the alterna community tending to be pretty insular. Once you get in to the groups though then they are not too difficult to get hold of


    Quote Originally Posted by nikkubus View Post
    Are they tricky to get eating rodents?
    They can be. My female took mice pinks from day one. My male I had to soak pinks in anole puree and then wrap them in gecko shed. That little ritual lasted six months before he started converting over. Once switched over they will eat just about anything. Mine love quail chicks and tilapia
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (03-03-2021),nikkubus (03-03-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1