» Site Navigation
1 members and 1,730 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,098
Threads: 249,239
Posts: 2,572,924
Top Poster: JLC (31,651)
|
-
-
The Following 13 Users Say Thank You to HarryTB For This Useful Post:
- + Show/Hide list of the thanked
-
Alicia (03-12-2021),aurum (03-03-2021),bns (03-05-2021),Bogertophis (03-02-2021),dakski (03-02-2021),EL-Ziggy (03-06-2021),Hugsplox (03-02-2021),jmcrook (03-02-2021),nikkubus (03-02-2021),richardhind1972 (03-03-2021),Spicey (03-03-2021),Toad37 (03-02-2021),Trinityblood (03-02-2021)
-
Very cool...you don't see very many GBKs around these days. I'm sworn to silence, no worries...
Nice match to your tat also.
Last edited by Bogertophis; 03-02-2021 at 04:21 PM.
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Re: Grey Banded Kingsnake
 Originally Posted by Bogertophis
Very cool...you don't see very many GBKs around these days.  I'm sworn to silence, no worries...
Nice match to your tat also.
thanks, I hadn’t seen one for years, I’m in the U.K., and 2 years ago I randomly called in a reptile store near to me and he was in there, only a few weeks old, and as they’ve been on my bucket list for years, I had to get him, but finding a female for him is near damn impossible. Yeah he definitely complements my tat 😉 what I love about him, I’ve had numerous types of kings and milks over the years and his temperament is the best I’ve ever had, he’s a real star, never struck or bit and calm as anything being handled
-
The Following 3 Users Say Thank You to HarryTB For This Useful Post:
Bogertophis (03-02-2021),nikkubus (03-02-2021),richardhind1972 (03-03-2021)
-
Re: Grey Banded Kingsnake
 Originally Posted by HarryTB
thanks, I hadn’t seen one for years, I’m in the U.K., and 2 years ago I randomly called in a reptile store near to me and he was in there, only a few weeks old, and as they’ve been on my bucket list for years, I had to get him, but finding a female for him is near damn impossible. Yeah he definitely complements my tat �� what I love about him, I’ve had numerous types of kings and milks over the years and his temperament is the best I’ve ever had, he’s a real star, never struck or bit and calm as anything being handled
I've never kept those, but I've heard their temperaments tend to be mellower than most other king snakes. I have an "odd" snake in that general category too, a Texas longnose snake (red, black & yellow bands), also mellow & sadly, also "single". Like yours, mine was from a local pet store, but was a c/b yearling that they were unable to feed much less sell. I traded them one of my c/b king snakes that they could EASILY feed & sell, & saved this snake, who's now 19 years old. Longnose snakes, either Western or TX, are primarily lizard-eaters & not easily persuaded to take mice, but they were also native to the California desert where I lived then, & I already had some experience with them . A characteristic they may share with some of the gray-bandeds, I think? A little harder to get started eating, but so pretty & calm, obviously well-worth the efforts. "Many good things DO come in small packages".
Last edited by Bogertophis; 03-02-2021 at 05:14 PM.
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following 2 Users Say Thank You to Bogertophis For This Useful Post:
HarryTB (03-03-2021),nikkubus (03-02-2021)
-
Very gorgeous. I haven't seen many around either. Are they tricky to get eating rodents?
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following User Says Thank You to nikkubus For This Useful Post:
-
Re: Grey Banded Kingsnake
 Originally Posted by nikkubus
Very gorgeous. I haven't seen many around either. Are they tricky to get eating rodents?
He was eating pinkies when I bought him and he’s a fantastic feeder, he smashes mice every time, even when in blue
-
The Following 2 Users Say Thank You to HarryTB For This Useful Post:
Bogertophis (03-03-2021),nikkubus (03-03-2021)
-
Re: Grey Banded Kingsnake
 Originally Posted by Bogertophis
I've never kept those, but I've heard their temperaments tend to be mellower than most other king snakes. I have an "odd" snake in that general category too, a Texas longnose snake (red, black & yellow bands), also mellow & sadly, also "single". Like yours, mine was from a local pet store, but was a c/b yearling that they were unable to feed much less sell. I traded them one of my c/b king snakes that they could EASILY feed & sell, & saved this snake, who's now 19 years old.  Longnose snakes, either Western or TX, are primarily lizard-eaters & not easily persuaded to take mice, but they were also native to the California desert where I lived then, & I already had some experience with them . A characteristic they may share with some of the gray-bandeds, I think? A little harder to get started eating, but so pretty & calm, obviously well-worth the efforts. "Many good things DO come in small packages". 
That’s a cool looking snake that Texas longnose, that’s a new one to me 😊 I’ve found a leucistic female for sale here, and I know they’ll throw “normal” babies, but the whole appeal of them to me is their colour/ pattern. The female also has a kink in its tail, which I have seen several times in leucistic specimens probably a genetic thing, and may possibly affect breeding 🤷🏻:cens0r:♂️ Never had a problem with this little one eating mice and rat pups, he’s a little beast 😂😂
-
The Following 2 Users Say Thank You to HarryTB For This Useful Post:
Bogertophis (03-03-2021),nikkubus (03-03-2021)
-
Re: Grey Banded Kingsnake
 Originally Posted by Bogertophis
I've heard their temperaments tend to be mellower than most other king snakes.
This is quite true. They are one of the most laid back species I have. Only ever taken a single bite and that was my fault for handling after eating crab and I guess the smell was enough to trigger a feed response.
 Originally Posted by nikkubus
Very gorgeous. I haven't seen many around either.
That is mostly down to the alterna community tending to be pretty insular. Once you get in to the groups though then they are not too difficult to get hold of
 Originally Posted by nikkubus
Are they tricky to get eating rodents?
They can be. My female took mice pinks from day one. My male I had to soak pinks in anole puree and then wrap them in gecko shed. That little ritual lasted six months before he started converting over. Once switched over they will eat just about anything. Mine love quail chicks and tilapia
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Bogertophis (03-03-2021),nikkubus (03-03-2021)
-
-
The Following User Says Thank You to richardhind1972 For This Useful Post:
-
Re: Grey Banded Kingsnake
 Originally Posted by HarryTB
That’s a cool looking snake that Texas longnose, that’s a new one to me ��...
Yes- mine is a beautiful tricolor. The pet store's source said it was eating mice pinks (& from the size it obviously was eating something to get to a still-tiny yearling size) but the pet store it was in had no luck feeding it at all- probably the lack of privacy & other issues of being on display. 
It refused pinks for me at home, but only at first. It had been a long time since it had eaten, so to give it some energy to make the appetite return, I gave a tube-feed of thinned Gerber's chicken baby food, & that worked very well. (I should note that I have a lot of experience at tube-feeding w/ a syringe & catheter.) Maybe a week after that (it was 18 years ago, lol), the snake acted hungry & when offered f/t pinkies, gulped them down enthusiastically & did from then on.
Note: I thaw frozen prey IN water, & for this kind of snake that's important, as it washes OFF some of the mouse odor/taste. For that reason, f/t is much better accepted than live or fresh. Also, because this species has such a narrow gape (hence the name), I don't & never have fed one item per feeding. Always this snake gulps down a number of the appropriate size prey (pinks then, now fuzzies) that I estimate will fill the stomach. Snake is currently 30" or more, so a meal is 5 or 6 fuzzies, always at night & drop fed.
This snake also refuses food in winter like clockwork for several months, even though not brumated (& loses some weight over winter, but not to a dangerous extent). Spring always is a fussy time when the snake is restless but still refuses food for a while. It's our springtime ritual, lol. (Perhaps looking for a non-existent mate, & btw, I've never sexed this snake, because I have zero intent of breeding them.)
Might be a neat species to work with, since they're so pretty, & small, docile pets once well-started, but not a "beginner" snake IMO. The wild Western Longnose snakes I encountered had less or no red at all, btw. All are challenging to get on mice- they'd be eating lizards or other tiny snakes in the wild.
Last edited by Bogertophis; 03-03-2021 at 12:37 PM.
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following 3 Users Say Thank You to Bogertophis For This Useful Post:
dakski (03-04-2021),HarryTB (03-03-2021),nikkubus (03-03-2021)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|