Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,307

1 members and 1,306 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,129
Posts: 2,572,290
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182

View Poll Results: Are enchi and cinammon/ black pastel allelic?

Voters
5. You may not vote on this poll
  • yes

    3 60.00%
  • No

    2 40.00%
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 24
  1. #11
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by bcr229 View Post
    Often with the allelic combos the offspring don't look like the parents. I mean, who would have thought that a super lesser/super mohave/lesser mohave/etc would be a white snake with blue eyes if you'd never seen one before? Or a super cinny/super black pastel/etc would be a solid gray/black snake? If you look at a cinnamon enchi or black pastel enchi they look as you'd expect: a mix of the two morphs. Super enchi looks like a reduced enchi, not something wildly different from what you'd expect.

    Then there is proving it. It might be easiest to pick out a super enchi + cinnamon or black pastel in a litter, because the other super forms are solid colors which could mask the enchi gene.
    I don't know that it would be considered proving it but I would think breeding a cinnamon enchi to any other combo and verifying all babies are enchi or cinnamon but not both would be a pretty good indication that they they are in fact allelic.

  2. #12
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by asplundii View Post
    If you do locate it, please link here. I would be interested in seeing what all he has done
    I'll try to do some digging and see if I can find where I read it. Depending on his results, it may be good enough proof for me. The only issue is, I didn't pay much attention to what all the offspring were other than not black pastel enchi. If all his pairings with his black pastel enchi did produce only one or the other in each pairing, that would pretty much prove it imo. I'll follow up if I can find it.

  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by rufretic View Post
    If all his pairings with his black pastel enchi did produce only one or the other in each pairing, that would pretty much prove it imo.
    Yes, this was what I said in my first reply here. A few clutches without replicating the double would be very strong evidence
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #14
    Registered User
    Join Date
    06-12-2018
    Posts
    1
    Thanks
    1
    Thanked 0 Times in 0 Posts

    Re: Thoughts on cinnamon and enchi being allelic?

    Hello everyone just found this thread. In 2017 I paired what was sold to me as a fire pewter to an enchi bumblebee. I produced 5 offspring
    1)https://www.instagram.com/p/Bm0uD5Gg...=1u0gdd1s13iuh
    2)https://www.instagram.com/p/Bm0tktGA...d=we2492a021kf
    3)https://www.instagram.com/p/Bm0uXBbA...d=lkav1ot3liuq
    4)https://www.instagram.com/p/Bm0u0T9A...d=qaa4xj5tpvlv
    5)https://www.instagram.com/p/Bm0tCT3g...d=208lrr8w6pyi
    I held back #1 & #5 because I didn’t know what was in them. In 2019 I bred #1 to a normal female and I produced this.https://www.instagram.com/p/CFPjf5Qs...=1r6mm9969e844
    I believe #5 has enchi in her and will try to pair with #1 and see what I get I will also try to reproduce #1 and #5 this year.

  5. #15
    BPnet Veteran
    Join Date
    12-10-2015
    Location
    Collegeville, Pennsylvania
    Posts
    229
    Thanks
    11
    Thanked 169 Times in 99 Posts

    Re: Thoughts on cinnamon and enchi being allelic?

    Well I guess i'll jump into this project and see my results for the next few years. I'm going to start pairing a Cinnamon enchi female with my banana pied male and will now not sell a black pastel banana male I had received as part of a trade and instead pair it with an enchi girl I was also considering selling due to her daughter (pastel lesser enchi) being up to size. These are the projects that get me excited, hopefully they produce for me in the next few years and I can post my results.

  6. #16
    Registered User benji4801's Avatar
    Join Date
    10-26-2020
    Location
    New York
    Posts
    5
    Thanks
    12
    Thanked 1 Time in 1 Post

    Re: Thoughts on cinnamon and enchi being allelic?

    So over on morph market lol. there is a super cinnamon enchi and i call bull. its by a big breeder too which is pretty disappointing.
    Last edited by Bogertophis; 03-01-2021 at 08:42 PM. Reason: toned down colorful language

  7. #17
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,848 Times in 973 Posts

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by benji4801 View Post
    So over on morph market lol. there is a super cinnamon enchi and i call bull. its by a big breeder too which is pretty disappointing.
    Yeah, it looks like a super cinny to me but there is no way they would be able to tell enchi is in there in that combo (other than that they should know it's not even possible).
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  8. #18
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,572
    Thanks
    2,977
    Thanked 10,009 Times in 4,841 Posts
    Images: 34

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by nikkubus View Post
    Yeah, it looks like a super cinny to me but there is no way they would be able to tell enchi is in there in that combo (other than that they should know it's not even possible).
    I thought it wasn't proven one way or another yet that enchi and cinnamon were allelic?

  9. #19
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,848 Times in 973 Posts

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by bcr229 View Post
    I thought it wasn't proven one way or another yet that enchi and cinnamon were allelic?
    worldofballpythons.com has changed the genetic calculator to reflect it. Enough people have clutch results from enchi cinnamons that it's safe to say it's proven. When breeding a cinnamon enchi to one that has neither, every single hatchling has one of the two genes, never neither, never both. The only way to produce a cinnamon enchi that we have seen is to have each parent have at least one of the two.

    There are many claims of "super enchi cinnamon" and two "super cinnamon enchi" (one of the two is listed "possible enchi") showing up on morph market (including past sales) but if you look at the animals, you have to wonder what gives the people identifying them this idea. I would want to see clutch results from these animals before making the claim they are those things if it were my reputation on the line.
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  10. #20
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,848 Times in 973 Posts

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by nikkubus View Post
    worldofballpythons.com has changed the genetic calculator to reflect it.
    Apparently I'm imagining things. I swear I saw it just a week or two ago show a 50/50 split out of enchi cinnamon to normal, but I just checked it again now and it's showing them as if they are not allelic. Either way, I stand by the rest of what I said and just wanted to correct that bit.

    JKR and MCC have both had multiple clutches that seem to confirm it allelic though. One clutch, two clutches... odds can be a bit crazy sometimes, but when multiple people are seeing it repeated without any evidence to the contrary I think it's too strong of evidence to deny.
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1