Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 624

0 members and 624 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Search Forums

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 2 of 2

Threaded View

  1. 09-21-2020, 08:50 AM #2
    asplundii
    asplundii is offline
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    No HGW.

    When combined with Mojave, HGW makes a somewhat SoulSucker-looking animal. Very strong dorsal stripe and reduction of lateral pattern
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
    Reply With Quote Reply With Quote

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Tila (09-21-2020)
« Previous Thread | Next Thread »

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  

Forum Rules
Powered by vBadvanced CMPS v4.2.1