Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

> FAQ

» Online Users: 582

0 members and 582 guests

No Members online

Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

None

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)

Welcome to our newest member, coda

Results 1 to 7 of 7

08-20-2020, 08:54 AM #7
asplundii

View Profile

View Forum Posts

View Blog Entries

View Gallery Uploads
BPnet Veteran

Join Date

10-17-2008

Posts

906

Thanks

103

Thanked 722 Times in 382 Posts
Re: How to make the Whitest BEL ??

Originally Posted by PartySnake13

it’s not associated specifically with the lesser gene.

Most super lessers do not have eye defects.
All spiders have a wobble.

Yes, it is specifically associated with Lesser. Any SuperLesser has the potential to have bug-eyes, there is not a "line" of bug-eye free Lessers. Just because they do not all manifest it does not mean it is unrelated to the gene.

actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Reply With Quote
The Following User Says Thank You to asplundii For This Useful Post:

jmcrook (08-20-2020)