» Site Navigation
0 members and 663 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Registered User
-
-
Any BluEL has the potential for a yellow dorsal forming. I have seen adults of all of those and all of them have had some degree of visual stripe
If you want a true, stark white animal then your best bets are all-white BlkEL or all-white Pieds
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
From what I understand, the whitest of white morphs come from White Wedding- which is a Spider Pied that just happens to come out all white.
If you're choosing out of that list, though... looking at them side by side, it looks like Super Lessers tend to come out brighter and have the yellow dorsal less often.
0.1 Normal [Artemis]
0.1 Super Pastel [Persephone]
1.0 Pastave [Chronos]
1.0 Blizzard Leopard Gecko [Dimitri]
1.1 Cats [Jesse McCree, Addison Sheppard]

-
-
Registered User
Re: How to make the Whitest BEL ??
Super Lessers routinely produce the whitest snakes in the BEL complex, it's infrequent for them to have an ivory dorsal stripe or light grey head stamp.
Of course, some pairings will produce eye defects in at least a snake or two every clutch, they can have eyes too small or bug eyes.
Other pairings will not produce eye defects.
Nobody knows exactly why it happens, my theory is that there is a gene floating around among the lessers, on it's own does not cause bug eyes, but when combined with 2 copies of lesser does cause bug eyes.
If it were me, I'd spring for an albino female with a gene from, the BEL complex with a year or two of age on her, such as a bamboo, lesser, mojave, russo.
From that pairing you can produce a BEL male thats het for albino, then run that male back to the female to produce REL's.
Last edited by JobForARetic; 08-17-2020 at 06:57 PM.
-
-
Re: How to make the Whitest BEL ??
 Originally Posted by JobForARetic
Nobody knows exactly why it happens, my theory is that there is a gene floating around among the lessers, on it's own does not cause bug eyes, but when combined with 2 copies of lesser does cause bug eyes.
The bug-eyes are an associated effect of the Lesser gene, much the same way that neuro is associated with Spider. That is why we see the same phenomenon in BluELs in other species like rat snakes and Burms and retics
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: How to make the Whitest BEL ??
 Originally Posted by asplundii
The bug-eyes are an associated effect of the Lesser gene, much the same way that neuro is associated with Spider. That is why we see the same phenomenon in BluELs in other species like rat snakes and Burms and retics
it’s not associated specifically with the lesser gene.
Most super lessers do not have eye defects.
All spiders have a wobble.
-
-
Re: How to make the Whitest BEL ??
 Originally Posted by PartySnake13
it’s not associated specifically with the lesser gene.
Most super lessers do not have eye defects.
All spiders have a wobble.
Yes, it is specifically associated with Lesser. Any SuperLesser has the potential to have bug-eyes, there is not a "line" of bug-eye free Lessers. Just because they do not all manifest it does not mean it is unrelated to the gene.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|