Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 666

0 members and 666 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 7 of 7
  1. #1
    Registered User
    Join Date
    07-27-2020
    Posts
    6
    Thanks
    2
    Thanked 2 Times in 2 Posts

    How to make the Whitest BEL ??

    I currently have a male lesser, and I'm planning to produce pure white BEL

    (wanna avoid the yellowish stripes along the spine)


    Lesser X Lessser
    Lesser X Mojave
    Lesser X Russo

    Among the three options above, what would make the pure whitest BEL??









  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Any BluEL has the potential for a yellow dorsal forming. I have seen adults of all of those and all of them have had some degree of visual stripe

    If you want a true, stark white animal then your best bets are all-white BlkEL or all-white Pieds
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    Registered User Tytysi's Avatar
    Join Date
    03-09-2020
    Posts
    32
    Thanks
    0
    Thanked 10 Times in 7 Posts
    Images: 5
    From what I understand, the whitest of white morphs come from White Wedding- which is a Spider Pied that just happens to come out all white.

    If you're choosing out of that list, though... looking at them side by side, it looks like Super Lessers tend to come out brighter and have the yellow dorsal less often.
    0.1 Normal [Artemis]
    0.1 Super Pastel [Persephone]
    1.0 Pastave [Chronos]
    1.0 Blizzard Leopard Gecko [Dimitri]
    1.1 Cats [Jesse McCree, Addison Sheppard]

  4. #4
    Registered User
    Join Date
    07-18-2020
    Posts
    55
    Thanks
    44
    Thanked 20 Times in 19 Posts

    Re: How to make the Whitest BEL ??

    Super Lessers routinely produce the whitest snakes in the BEL complex, it's infrequent for them to have an ivory dorsal stripe or light grey head stamp.


    Of course, some pairings will produce eye defects in at least a snake or two every clutch, they can have eyes too small or bug eyes.
    Other pairings will not produce eye defects.

    Nobody knows exactly why it happens, my theory is that there is a gene floating around among the lessers, on it's own does not cause bug eyes, but when combined with 2 copies of lesser does cause bug eyes.


    If it were me, I'd spring for an albino female with a gene from, the BEL complex with a year or two of age on her, such as a bamboo, lesser, mojave, russo.
    From that pairing you can produce a BEL male thats het for albino, then run that male back to the female to produce REL's.
    Last edited by JobForARetic; 08-17-2020 at 06:57 PM.

  5. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: How to make the Whitest BEL ??

    Quote Originally Posted by JobForARetic View Post
    Nobody knows exactly why it happens, my theory is that there is a gene floating around among the lessers, on it's own does not cause bug eyes, but when combined with 2 copies of lesser does cause bug eyes.
    The bug-eyes are an associated effect of the Lesser gene, much the same way that neuro is associated with Spider. That is why we see the same phenomenon in BluELs in other species like rat snakes and Burms and retics
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #6
    Registered User PartySnake13's Avatar
    Join Date
    07-03-2019
    Posts
    98
    Thanks
    145
    Thanked 29 Times in 21 Posts

    Re: How to make the Whitest BEL ??

    Quote Originally Posted by asplundii View Post
    The bug-eyes are an associated effect of the Lesser gene, much the same way that neuro is associated with Spider. That is why we see the same phenomenon in BluELs in other species like rat snakes and Burms and retics

    it’s not associated specifically with the lesser gene.

    Most super lessers do not have eye defects.
    All spiders have a wobble.

  7. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: How to make the Whitest BEL ??

    Quote Originally Posted by PartySnake13 View Post
    it’s not associated specifically with the lesser gene.

    Most super lessers do not have eye defects.
    All spiders have a wobble.
    Yes, it is specifically associated with Lesser. Any SuperLesser has the potential to have bug-eyes, there is not a "line" of bug-eye free Lessers. Just because they do not all manifest it does not mean it is unrelated to the gene.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following User Says Thank You to asplundii For This Useful Post:

    jmcrook (08-20-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1