Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 594

1 members and 593 guests
FJC,
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 3 of 3
  1. #1
    Registered User Kingdomall's Avatar
    Join Date
    06-07-2020
    Posts
    41
    Thanks
    0
    Thanked 14 Times in 8 Posts

    Lavender BEL Ball Python...

    So we know that albino BELs (blue eyed leucistic) are called cherrybombs. they are all white with red eyes. but what I wonder is... how would a lavender affect BEL?
    We know that the eyes would be red. And honestly from googling I didn't find any lavender BEL pythons anywhere. It intrigued me.
    Lavenders start off looking a lot like albinos, but with every shed their white parts turn a lot more purple. By the time it's an adult, you couldn't guess that an animal is the same aside from the pattern.
    Would a Lavender BEL turn purple with age? There are mojave lavenders but only of babies.
    Has NO ONE tried this? Really? If anyone has, please comment about it!
    I'd like to get everyone's thoughts on this.

  2. #2
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,907
    Thanks
    867
    Thanked 4,101 Times in 1,513 Posts
    Images: 120

    Re: Lavender BEL Ball Python...

    Quote Originally Posted by Kingdomall View Post
    I'd like to get everyone's thoughts on this.
    There are millions of combinations of ball python morphs that can be produced with the current gene pool. Pick any combination of genes and ask why it hasn't been produced and the answer will usually be one of three choices:

    -No one has gotten to it yet
    -The visible morph will be too close to another to be worth the effort
    -There is a lethal genetic combo at play

    Last edited by Lord Sorril; 07-23-2020 at 07:40 AM.
    *.* TNTC

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    A Lav BluEL would look the same as an Albino BluEL. They eyes might get a little darker as adults (the same way the eyes of regular Lavs get darker than the eyes Albinos) but nothing appreciably different
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1