Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 738

0 members and 738 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Search Forums

» Today's Birthdays

Banjomule (45)

» Stats

Members: 75,900
Threads: 249,095
Posts: 2,572,066
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 10 of 16

Threaded View

  1. 07-14-2020, 08:37 AM #9
    asplundii
    asplundii is offline
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Parthenogenesis?

    Quote Originally Posted by Matt850 View Post
    It is so odd to me that a first time mom would use parthenogenesis to reproduce, most of the examples I've found have been older animals who were never paired with a mate...
    Can happen at any age/time. I had an animal that switched back and forth over the course of five clutches
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
    Reply With Quote Reply With Quote

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    dr del (07-14-2020),Matt850 (07-21-2020)
« Previous Thread | Next Thread »

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  

Forum Rules
Powered by vBadvanced CMPS v4.2.1