» Site Navigation
0 members and 2,161 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,107
Threads: 249,255
Posts: 2,573,004
Top Poster: JLC (31,651)
|
-
-
-
Re: Parthenogenesis?
Can we see pictures of the offspring?
There are multiple gene combinations that can result in a BEL.
-
-
Registered User
-
The Following User Says Thank You to Matt850 For This Useful Post:
-
Registered User
Re: Parthenogenesis?
I have been thinking of any other possibility and I realized that I only have one other snake with the possibility to make a Lucy. A butter Het ghost Het clown. He was only 500 grams and maybe 7-8mo old at the time so while it's possible he was mature it isn't as likely.
If somehow these two locked then I also have a chance of one of these guys being clown as well. Either way I think that I will be keeping all three. I don't like the idea of having to tell someone that I'm not 100% sure what they are getting.
I'm usually ultra safe when pairing and plan ahead so it is still kinda odd to me that I would do this with an immature male. These two are also not even in the same rack.
Sent from my SM-N950U using Tapatalk
Last edited by Matt850; 07-11-2020 at 07:20 PM.
1.0 Enchi Banana
1.0 Clown
0.1 GHI
0.1 Mojave Het. Clown
0.1 Stinger Bee
0.1 Black Pewter
0.1 Hypo Butter
-
-
Re: Parthenogenesis?
Neat snakes! Hope you didn't open them up wider just for pics-they don't seem fully 'cooked' yet.
Interesting that all three are BELs. If we apply Mendelian Genetics there would be:
1/64 chance of that outcome with Butter x Mojave and a 1/8 chance if using a Super Butter x Mojave.
If I had three eggs and three BELs in this situation I would wonder if I labeled the egg bin with the parents correctly.
-
The Following 2 Users Say Thank You to Lord Sorril For This Useful Post:
Bogertophis (07-12-2020),jmcrook (07-12-2020)
-
Registered User
I appreciate the comments and thoughts. I cut at the 58 day mark because they were shriveling up quite a bit and one had pipped. The first pic was from a few hours ago and the other two were right after cutting. I probably cut more than I normally do in my excitement but the cuts look a lot smaller in person and I left the flaps on them to help with the humidity. I'm going to just let them be for a few days and once they come out I will start putting them in my baby rack.
I don't have quite as many pairs as many of the people who do this (only two official male breeders). The noodles in my signature are pretty much my only breeders atm. I have been raising up three Butter babies from a pairing of my Clown and Hypo Butter, one of those is the one I am thinking may have something to do with this. The more I think about it, the only thing I can come up with is that I may have put my male in with the mojave by mistake while cleaning, but that would have been an incredibly short time for them to breed and obviously I normally use an empty tub for this. After these three I am definitely going to have to increase the genetic diversity of my collection. Going to grab a black light to see if I can guess if any miraculously have clown as well (Imperial Clown) just to better understand what may have happened. Not sure which way I am going to go in the end, have to see what catches my eye, my main concern atm is keeping them all healthy.
Last edited by Matt850; 07-11-2020 at 11:28 PM.
1.0 Enchi Banana
1.0 Clown
0.1 GHI
0.1 Mojave Het. Clown
0.1 Stinger Bee
0.1 Black Pewter
0.1 Hypo Butter
-
-
Parthenogenesis creates "half-clones" of the mother. Any gene that the mother would pass on gets doubled so parth, in this case, could certainly generate BluELs. All of the offspring will also be female.
If you have a UV light you can fluoresce them and see if any of them are also Clown, though with a dirty BluEL like SuperMojave you might not even need to do that.
The attrition rate of the clutch is not uncommon with parth. There is also a general increase in defects in parth clutches, so do not be surprised if some of these have "issues"
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: Parthenogenesis?
 Originally Posted by asplundii
Parthenogenesis creates "half-clones" of the mother. Any gene that the mother would pass on gets doubled so parth, in this case, could certainly generate BluELs. All of the offspring will also be female.
If you have a UV light you can fluoresce them and see if any of them are also Clown, though with a dirty BluEL like SuperMojave you might not even need to do that.
The attrition rate of the clutch is not uncommon with parth. There is also a general increase in defects in parth clutches, so do not be surprised if some of these have "issues"
I think this is the answer I was looking for but not hoping for. I woke up to a not so pleasant sight. One of the babies was mostly out and rigor had set in, another had appeared to die in the egg. The one that crawled out was pretty kinked, and had a duck bill. I didn't think to take a picture of it before I buried it. I am down to one out of the original four eggs. The remaining one appears strong, when I checked on it after work I was a bit worried, it was sticking its head up looking around but it was wobbling a bit back and forth.. kinda like a newborn trying to crawl for the first time. It had maybe an inch and a half of neck outside the egg. It has strong reactions and seems alert so I am hopeful.
It is so odd to me that a first time mom would use parthenogenesis to reproduce, most of the examples I've found have been older animals who were never paired with a mate... but it is what it is and I will try to get this last guy to have the best opportunity for life.
I'll try to update in a week or two when the new guy finally emerges from his/her egg.
1.0 Enchi Banana
1.0 Clown
0.1 GHI
0.1 Mojave Het. Clown
0.1 Stinger Bee
0.1 Black Pewter
0.1 Hypo Butter
-
-
Re: Parthenogenesis?
 Originally Posted by Matt850
It is so odd to me that a first time mom would use parthenogenesis to reproduce, most of the examples I've found have been older animals who were never paired with a mate...
Can happen at any age/time. I had an animal that switched back and forth over the course of five clutches
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
dr del (07-14-2020),Matt850 (07-21-2020)
-
Registered User
Re: Parthenogenesis?
So, I have a questionable partho clutch also. I just want to clarify… if mom is a YB, will the babies all be YBs, or Super YBs?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|