Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 879

0 members and 879 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,900
Threads: 249,096
Posts: 2,572,067
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 10 of 16

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Parthenogenesis creates "half-clones" of the mother. Any gene that the mother would pass on gets doubled so parth, in this case, could certainly generate BluELs. All of the offspring will also be female.

    If you have a UV light you can fluoresce them and see if any of them are also Clown, though with a dirty BluEL like SuperMojave you might not even need to do that.

    The attrition rate of the clutch is not uncommon with parth. There is also a general increase in defects in parth clutches, so do not be surprised if some of these have "issues"
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (07-13-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1