Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,768

1 members and 1,767 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,104
Threads: 249,254
Posts: 2,572,984
Top Poster: JLC (31,651)
Welcome to our newest member, GarlandFbj
Results 1 to 5 of 5
  1. #1
    Registered User Kingdomall's Avatar
    Join Date
    06-07-2020
    Posts
    41
    Thanks
    0
    Thanked 14 Times in 8 Posts

    Albino and Lavender

    Hello there,
    I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
    Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
    If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
    Thanks.
    Last edited by Kingdomall; 06-09-2020 at 03:05 PM.

  2. #2
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1

    Re: Albino and Lavender

    Quote Originally Posted by Kingdomall View Post
    Hello there,
    I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
    Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
    If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
    Thanks.
    They are not the same and are not compatible so if you were to breed Lavender to Albino you would get some Double Hets, by breeding those double hets you would have 1/16 chance to produce a Double Recessive however will it be different or easily idenfiable it not likely.
    Deborah Stewart


  3. The Following User Says Thank You to Stewart_Reptiles For This Useful Post:

    PartySnake13 (06-09-2020)

  4. #3
    Registered User PartySnake13's Avatar
    Join Date
    07-03-2019
    Posts
    98
    Thanks
    145
    Thanked 29 Times in 21 Posts

    Re: Albino and Lavender

    Quote Originally Posted by Kingdomall View Post
    Hello there,
    I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
    Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
    If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
    Thanks.

    There are numerous locations where a spontaneous mutation can occur, causing the disruption of one step in the melanin production process and resulting in an albino snake.
    The albino and lavender albino genes are located on different alleles, therefore if bred together the offspring will still have one working melanin production gene at both alleles.


    For example, Albino and Candy are located on the same allele, therefore breeding them together will produce an intermediate form of albinism known as a candino.


    When breeding an Albino to a Lavender Albino each parent passes on one copy of their different albino gene and one normal gene for the opposing form of albino.
    A lavender albino has 2 normal alleles for albino; an albino has 2 normal alleles for lavender albino.


    Producing visual/ double homologous lavender albino albinos would likely be an waste of time/ resources, only resulting in an albino looking animal with a possible pattern influence from the lavender trait, as the albino gene's inability to produce blue pigment would likely dominate the lavender albino genes colors, and at the end of the day there are much more rewarding double het projects.
    Last edited by PartySnake13; 06-09-2020 at 03:47 PM.

  5. The Following User Says Thank You to PartySnake13 For This Useful Post:

    Ronniex2 (07-18-2022)

  6. #4
    Registered User Kingdomall's Avatar
    Join Date
    06-07-2020
    Posts
    41
    Thanks
    0
    Thanked 14 Times in 8 Posts

    Re: Albino and Lavender

    thank you for your responses, I appreciate it greatly

  7. The Following User Says Thank You to Kingdomall For This Useful Post:

    PartySnake13 (06-09-2020)

  8. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Albino and Lavender

    Quote Originally Posted by PartySnake13 View Post
    The albino and lavender albino genes are located on different alleles, therefore if bred together the offspring will still have one working melanin production gene at both alleles.

    For example, Albino and Candy are located on the same allele, therefore breeding them together will produce an intermediate form of albinism known as a candino.
    As a point of clarification:

    Alleles are different versions of the same gene. So Albino and Candy are alleles which is why they are compatible and make the heteroallelic Candino

    Albino and Lav are two completely different, unrelated genes. Because of this, they are not alleles
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following User Says Thank You to asplundii For This Useful Post:

    Ronniex2 (07-18-2022)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1