Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,855

1 members and 1,854 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,107
Threads: 249,255
Posts: 2,573,000
Top Poster: JLC (31,651)
Welcome to our newest member, cheeseburger
Results 1 to 7 of 7
  1. #1
    Registered User soapapilla's Avatar
    Join Date
    03-03-2019
    Location
    Boulder, CO, USA
    Posts
    22
    Thanks
    20
    Thanked 2 Times in 2 Posts

    What do you look for / plan when acquiring potential future breeders?

    Hello everyone -- I am new to the ball python world (although a long-time snake lover) and I am preparing to purchase my first BP after lots of research! I'm still a newbie, of course, but a few years down the line once I have ample experience with care and keeping of BPs and a nice collection, I'd love to start breeding! Putting aside the fact of how much I have yet to learn, what do you breeders look for in snakes when building a collection? How do you plan future lines and make genetic choices? What would you tell your younger selves if you could change the way you started out? Do you do anything differently to prepare a young snake for future breeding? Thanks for any advice you might have!

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I pick a specific direction and then I choose/hold-back animals that allow me to stay on that direction.

    As an example, I like Albino/Candino and I have a specific project tailored to those. One of the animals I picked up this year for that will forward the project - a Candino GHI Spotnose. I will not be putting it to my base Candino because I do not just want to make more of the same things I have, I want to move the project forward. Instead, I put to either my Mojave het Albino or my Candino Woma or my Albino Acid to make new things.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Alicia (05-21-2020),Kamryn (09-24-2020),soapapilla (05-28-2020)

  4. #3
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1
    I pick according to the big picture.

    When breeding you need to have goals and acquire and or holdback your animals based on that not because something is cheap or available.

    So the first step is to define YOUR goals.

    Now what would I have done differently? I would have narrow down my project from the start but 14 years ago I wanted to work with everything and really did not accomplished much as I was too spread out so I had to restructure to finally get where I wanted to be.
    Deborah Stewart


  5. The Following 3 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    Alicia (05-21-2020),Kamryn (09-24-2020),soapapilla (05-28-2020)

  6. #4
    Registered User
    Join Date
    10-19-2019
    Location
    North Eastern Arizona
    Posts
    66
    Thanks
    0
    Thanked 61 Times in 32 Posts
    Images: 3
    I had my first successful breeding season this year. I have one clutch in the incubator and I think one more on the way. I’m a hobby breeder with a full time job. I also don’t have a ton of room so a huge collection isn’t going to happen any time soon. I plan on breeding around 8 females a year. I’m going to assume you’ve gotten husbandry down and have figured out how to breed them. It’s really not that tough.

    I would start by figuring out what you want to get out of this. I know it’s kind of cliche, but I think It really helps to have a vision. It will help you focus your investment. You don’t want to by a bunch of snakes and realize they aren’t things you can use in your breeding plans. Again I don’t have a ton of room, so space is at a premium. I have a 2000 gram calico female that I may breed once. This is a mistake I made. She was cheap and healthy so I got her thinking I would breed her. I wanted calico in my collection, but all I was looking for was a big girl. Now she doesn’t really fit into any of my plans. It would have made more sense for me to spend a little more money and get a smaller female with calico plus other genes I wanted. I may end up giving her to a friend.

    I got my females first and raised them up. Males mature faster and can breed multiple females. I have about a 1:3 male:female ratio.

    For me it makes more sense to purchase the best females I can afford. I’d rather spend $1000 on one visual desert ghost than $1000 on three hets. Having a visual female faster, means I can get more genes into my project if by breeding her to males with the genes I want and making my own hets. I can then breed my best het male to my visual females the next year. If you aren’t going to go with recessives, I would try to get multi gene females. Remember my calico female. It would have been better for me to get one female with calico plus a few more genes, even if I needed to raise her up. One good multi gene female may cost me more, but I’m not feeding or housing as many snakes.


    If you are going to breed you’ll need to make sure you have a reliable source of live food. That might mean breeding your own rodents.

    One other thing, I spoke to local pet stores before I started. I wanted to make sure I had a place that would take my normals or single gene animals. I wanted to make sure I wouldn’t end up with a bunch of babies that I would end up feeding and housing for the rest of their lives.

  7. The Following 2 Users Say Thank You to AzJohn For This Useful Post:

    Kamryn (09-24-2020),soapapilla (05-28-2020)

  8. #5
    BPnet Veteran Alicia's Avatar
    Join Date
    07-22-2010
    Location
    Pacific NW
    Posts
    519
    Thanks
    3,759
    Thanked 423 Times in 269 Posts
    Images: 1
    What asplundii and Deborah said, regarding having a goal and making your breeding decisions around it.

    To that, I would add having an image in your mind of what the best examples of that goal, and the mutations you'll need to reach it, and try to keep your purchases and holdbacks as close to that image as possible. But also try not to get male-heavy with those holdbacks. That was my biggest mistake early on, letting go of girls I could have used to help further my project.

  9. The Following 2 Users Say Thank You to Alicia For This Useful Post:

    Kamryn (09-24-2020),soapapilla (05-28-2020)

  10. #6
    Registered User
    Join Date
    03-31-2020
    Posts
    108
    Thanks
    19
    Thanked 37 Times in 33 Posts
    This is just some planning advice ...As everyone has mentioned, decide what your end goal or big picture will be. Plan ahead by researching the different dominant, and recessive genes related to your desired traits. You'll learn that some will result in co-dominance, or incomplete dominance. A really handy tool is using punnet squares. If you have experience with punnet squares, then awesome, if not, definitely learn about and how to use it. It will help you figure out the probability of your clutch, and how many generations it will take to get to where you want to be. Knowing this information, you can then decide if you want to purchase snakes that have those genetic dispositions already, which could save you time, money and effort.

    I don't have any breeding experience, so I can't put in much else, but I wish you the best in the future, and hope that your goals are met.

  11. The Following 2 Users Say Thank You to Faith.luu For This Useful Post:

    Kamryn (09-24-2020),soapapilla (05-28-2020)

  12. #7
    BPnet Veteran
    Join Date
    10-18-2018
    Location
    Brady, TX
    Posts
    224
    Thanks
    37
    Thanked 264 Times in 129 Posts
    Images: 21
    I asked a similar thing in a longer format but didn't get much traction. I'm looking to understand how people plan their own long term breeding projects comparative to what I am doing.

    I am currently a Hobbyist myself and have one clutch about to pip and a second to be laid. I have a couple other paired females that may go late.

    Personally, I love gene stacking. I think that there are some serious combo potentials that haven't been explored. There are also a few genes out there that very few are working into their projects that I think would actually enhance the ideal end state.

    I've found that I buy snakes for these reasons:

    1) I am adding a gene and is has a combination package that would allow me to produce a short cut to my own goals without having to produce the combo myself.

    2) I am adding a gene and the gene is new or uncommon enough that I will not likely find the right combo and will need to work it that way myself.


    In the last 6 months I've added a few animals. And the reason I bought them.

    Huffman Orange Ghost - #1
    VPI Axanthic Ghost - #1
    Highway het Hypo - #1

    Super Black Head - #2

    I'm wishing now that I had a few more homozygous Orange Ghost girls in my collection, but I am currently heavily skewed towards females.

    My 2c

    Paul

  13. The Following 2 Users Say Thank You to pbenner For This Useful Post:

    Kamryn (09-24-2020),soapapilla (05-28-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1