Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,518

0 members and 1,518 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 1 of 2 12 LastLast
Results 1 to 10 of 14

Thread: Animal Plastics

  1. #1
    Registered User Alien's Avatar
    Join Date
    11-10-2019
    Posts
    84
    Thanks
    106
    Thanked 66 Times in 32 Posts

    Animal Plastics

    I ordered my A10 Animal Plastics arboreal enclosure on November 8 2019 and it arrived today just shy of 6 months!, 26 weeks. My only real complaint is he charges your credit card at the time of order and I believe this is against his credit card agreement?

    I don't even have the snake that is going in this enclosure so I ordered with plenty of time. I also had a couple of requests and he was able to accommodate them. He installed a heat panel, a screen, and 2 LED light strips. I wanted 2 because I like to have 1 I can turn on at any time if I want or need to see inside the enclosure and the other one controlled by the herpstat.

    He does nice work and packages very well. Out of all the options he is a great deal if you are not in a rush, I wasn't. I built my Boa a large enclosure because I could build a decent large enclosure for less than he would charge after shipping is included. Just my honest opinion.

  2. #2
    BPnet Lifer Reinz's Avatar
    Join Date
    08-05-2013
    Location
    East TX
    Posts
    8,019
    Thanks
    5,613
    Thanked 4,602 Times in 3,139 Posts
    Images: 9
    I have bought 6 APs and have two on order. I never HAD TO pay in full in advance. They let ME decide on an agreeable deposit and decide if I want to make payments or pay in full when they are to be shipped.

    They are extremely EASY to work with.
    Last edited by Reinz; 05-05-2020 at 06:09 AM. Reason: Spaz typing
    The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.

    1.2 Coastal Carpet Pythons
    Mack The Knife, 2013
    Lizzy, 2010
    Etta, 2013
    1.1 Jungle Carpet Pythons
    Esmarelda , 2014
    Sundance, 2012
    2.0 Common BI Boas, Punch, 2005; Butch, age?
    0.1 Normal Ball Python, Elvira, 2001
    0.1 Olive (Aussie) Python, Olivia, 2017

    Please excuse the spelling in my posts. Auto-Correct is my worst enema.

  3. The Following User Says Thank You to Reinz For This Useful Post:

    jmcrook (05-05-2020)

  4. #3
    BPnet Veteran Team Slytherin's Avatar
    Join Date
    09-12-2017
    Location
    Los Angeles, CA
    Posts
    608
    Thanks
    556
    Thanked 865 Times in 404 Posts
    Images: 1

    Re: Animal Plastics

    Quote Originally Posted by Reinz View Post
    I have bought 6 APs and have two on order. I never HAD TO pay in full in advance. They let ME decide on an agreeable deposit and decide if I want to make payments or pay in full when they are to be shipped.

    They are extremely EASY to work with.
    Thank you for this! I had no idea. That definitely changes my future plans.

  5. #4
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,572
    Thanks
    2,977
    Thanked 10,009 Times in 4,841 Posts
    Images: 34

    Re: Animal Plastics

    Quote Originally Posted by Alien View Post
    I ordered my A10 Animal Plastics arboreal enclosure on November 8 2019 and it arrived today just shy of 6 months!, 26 weeks. My only real complaint is he charges your credit card at the time of order and I believe this is against his credit card agreement?

    I don't have my merchant processor agreement in front of me but I believe that I have 30 days to ship product or start providing service from the date the card is charged unless the customer agrees to a longer timeframe. I would read their TOS and see if there's any verbiage about delivery dates.


  6. #5
    BPnet Royalty EL-Ziggy's Avatar
    Join Date
    11-05-2014
    Location
    GA
    Posts
    4,224
    Thanks
    5,090
    Thanked 5,533 Times in 2,710 Posts

    Re: Animal Plastics

    I've never had to pay in full in advance for my AP cages either. I typically pay half the balance when I place the order and the remainder when the items are ready to ship. That seems pretty fair to me. Other than the long wait times I have nothing bad to say about AP products or customer service.
    Last edited by EL-Ziggy; 05-05-2020 at 09:56 AM.
    3.0 Carpet Pythons, 1.1 Bullsnakes
    1.0 Olive Python 1.0 Scrub Python,
    1.0 BI, 0.1 BCO

  7. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Animal Plastics

    Quote Originally Posted by Alien View Post
    [LEFT][COLOR=#222222][FONT=Tahoma]I ordered my A10 Animal Plastics arboreal enclosure on November 8 2019 and it arrived today just shy of 6 months!, 26 weeks.
    Let me guess... They somehow managed to misplace/misfile/lose the paper copy of your order so it did not make it back into the shop?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #7
    BPnet Lifer jmcrook's Avatar
    Join Date
    04-05-2016
    Location
    Mississippi
    Posts
    3,666
    Thanks
    7,866
    Thanked 7,254 Times in 2,661 Posts
    Images: 12

    Animal Plastics

    Quote Originally Posted by asplundii View Post
    Let me guess... They somehow managed to misplace/misfile/lose the paper copy of your order so it did not make it back into the shop?
    My guess is it had something to do with them being a smaller, family run business with hundreds, if not thousands, of orders placed ahead of this one...


    Sent from my iPhone using Tapatalk
    Last edited by jmcrook; 05-05-2020 at 10:20 AM.

  9. The Following User Says Thank You to jmcrook For This Useful Post:

    AbsoluteApril (05-05-2020)

  10. #8
    BPnet Veteran
    Join Date
    10-18-2018
    Location
    Brady, TX
    Posts
    224
    Thanks
    37
    Thanked 264 Times in 129 Posts
    Images: 21
    I will preface this by saying that I have been an AP fanboy since I was in High School, and decided a long, long time ago, that if I ever wanted to do this for real, that I'd be outfitting my facility with their stuff.

    There is another thread where you can see my lead-times on the stuff that I ordered, I could go back and look at history too, but everything has been within what they quoted me at the time I placed the order. I spoke with them last week and was told they are at the tail end of their moved and are currently in the process of moving out of their older, smaller facility and into their new, larger facility and getting both CNCs running full time. This will lessen their lead times. I was also told 17 to 18 weeks currently for any orders being placed. I ordered anyways.

    I currently have:

    (1) 375 6 high
    (1) 330 6 high
    (2) 570 10 high

    The only thing I didn't purchase from them was my incubator. I did this mainly out of need, but also out of respect of the opinions of a couple people on this forum and have a Hot Box Incubator (I love it too).

    I just order a new rack for QT (375 4 high) and a rack for a friend too (570 5 high). But, what they've allowed me to do in the past is to get a smaller part of my order going and add to it as I can. I've never asked about a partial and then full payment before, but I'm sure they'd let me do that too. They're a great company.

    I plan on ordering another 570 at the end of May, maybe two of them just to be safe on being able to keep hold backs. I REALLY need to make an update post for everything going on in my world snake wise.

    2c and worth the paper it's written on.

    Best,

    Paul

  11. #9
    BPnet Veteran wnateg's Avatar
    Join Date
    07-25-2019
    Location
    TX
    Posts
    837
    Thanks
    684
    Thanked 1,020 Times in 465 Posts

    Re: Animal Plastics

    Quote Originally Posted by jmcrook View Post
    My guess is it had something to do with them being a smaller, family run business with hundreds, if not thousands, of orders placed ahead of this one...


    Sent from my iPhone using Tapatalk
    Sounds like it's time for an upgrade then.
    Last edited by wnateg; 05-05-2020 at 11:04 AM.
    Start your own dubia roach colony with Roach Rancher!

    Instagram - @AliceAnaconda

    0.1.0 Cat "Anna"
    -----
    1.1.0 Emerald Tree Boa "Amanda & Samantha"
    0.1.0 Merauke Scrub Python "Victoria"
    0.1.0 Titanium Reticulated Python "Alice"
    1.0.0 Eastern Indigo
    -----
    0.0.4 Alligator Snapping Turtle "Deborah"
    0.0.2 Florida Snapping Turtles
    0.0.1 Cuvier's Dwarf Caiman "Caroline"
    0.0.1 100% Het Black Dragon Asian Water Monitor
    -----
    0.0.1 Antilles Pink Toe Tarantula "Katherine"

  12. #10
    BPnet Lifer jmcrook's Avatar
    Join Date
    04-05-2016
    Location
    Mississippi
    Posts
    3,666
    Thanks
    7,866
    Thanked 7,254 Times in 2,661 Posts
    Images: 12

    Re: Animal Plastics

    Quote Originally Posted by wnateg View Post
    Sounds like it's time for an upgrade then.
    https://apcages.com/blogs/news


    Sent from my iPhone using Tapatalk

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1