Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 608

1 members and 607 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer

View Poll Results: Are enchi and cinammon/ black pastel allelic?

Voters
5. You may not vote on this poll
  • yes

    3 60.00%
  • No

    2 40.00%
Page 1 of 3 123 LastLast
Results 1 to 10 of 24
  1. #1
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Thoughts on cinnamon and enchi being allelic?

    Hi,

    I fist saw this on one of mutation creations videos and then on one of robert barracloughs where he sowed a few interesting animals regarding it.

    https://www.youtube.com/watch?v=RvqDE9TNkis

    Shared as a link as I haven't managed to ask him if it is ok to share off his youtube page.

    I wandered on to morph market and all I could see to ginsay it were two examples labled super enchi black pastel. And nothing I could see screamed definate black pastel.

    Have I simly not been paying attention and this has been known for a while?


    del
    Last edited by dr del; 04-12-2020 at 12:51 AM. Reason: got a name wrong 'cos I'm a doofus.
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  2. #2
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,570
    Thanks
    2,971
    Thanked 10,004 Times in 4,839 Posts
    Images: 34
    If they are it's the first I've heard of it.

  3. #3
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: Thoughts on cinnamon and enchi being allelic?

    Me too,

    But when you go looking on world of ball pythons the only super cinny/ blackpastel is one that we already know is impossible.

    http://www.worldofballpythons.com/mo...uper-cinnamon/

    Not a single super cinny or black pastel with enchi in it at all.

    I think this is the video I first heard it;

    https://www.youtube.com/watch?v=4B-2d4BC10Y

    **ETA** It is at 19:30 he mentions it.

    I honestly don't know what to think about it right now.


    del
    Last edited by dr del; 04-12-2020 at 01:19 AM.
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  4. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    This is a conversation that has come up in about the last three or so months. It is... interesting but very few of the people weighing in have done what I would call definitive breeding trials to prove it out. Which is funny because you would thing a BlkComplex Enchi animal bred to a normal normal or three would be child's play
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #5
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11
    This is very interesting and the first I've heard of it. But what's really interesting is I just recently read a post from a breeder, can't remember where but I'm guessing facebook, but it was about his blanchi project I think he called it, or black pastel enchi project. It relates to this specifically because the jist of his post was that he's been trying to make more of them but he just can't seem to hit a black pastel enchi again and he said he'd tried for the last 3 years or something like that but can't hit it. He listed a bunch of pairings which I can't remember now but I believe they were all using his black pastel enchi. Now that would make a lot more sense than just being unlucky. The black pastel enchi wouldn't be able to reproduce itself unless it got one or the other genes from the other parent if they are allelic. This post would almost be proof, he listed quite a few pairings he tried over the years and did not hit one black pastel enchi. I just wish I could remember where I read it so I could confirm, but this would definitely make sense and I'm sure this breeder would love to realize they are allelic as well so he could understand why he has been so 'unlucky' lol.

  6. #6
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,570
    Thanks
    2,971
    Thanked 10,004 Times in 4,839 Posts
    Images: 34
    Now everyone with cinnamon, black pastel, and enchi in their collections is going to try to prove this out.

  7. #7
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by bcr229 View Post
    Now everyone with cinnamon, black pastel, and enchi in their collections is going to try to prove this out.
    Haha, you're so right! I'm already waiting for a clutch from enchi pastel DG x cinnamon genetic black back and I was planning to hold back an enchi cinnamon. Now I'm really hoping I hit one because I'll definitely be keeping this in mind when I choose my future pairings, not just to prove it out but also so I don't make impossible to hit goals lol.

  8. #8
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11
    My only issue with this is, how the heck has this not already been proven with such common morphs?! It makes you wonder how many other crazy genetic secrets are yet to be discovered lol.

  9. #9
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,570
    Thanks
    2,971
    Thanked 10,004 Times in 4,839 Posts
    Images: 34

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by rufretic View Post
    My only issue with this is, how the heck has this not already been proven with such common morphs?! It makes you wonder how many other crazy genetic secrets are yet to be discovered lol.
    Often with the allelic combos the offspring don't look like the parents. I mean, who would have thought that a super lesser/super mohave/lesser mohave/etc would be a white snake with blue eyes if you'd never seen one before? Or a super cinny/super black pastel/etc would be a solid gray/black snake? If you look at a cinnamon enchi or black pastel enchi they look as you'd expect: a mix of the two morphs. Super enchi looks like a reduced enchi, not something wildly different from what you'd expect.

    Then there is proving it. It might be easiest to pick out a super enchi + cinnamon or black pastel in a litter, because the other super forms are solid colors which could mask the enchi gene.

  10. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Thoughts on cinnamon and enchi being allelic?

    Quote Originally Posted by rufretic View Post
    I just recently read a post from a breeder, can't remember where but I'm guessing facebook, but it was about his blanchi project I think he called it, or black pastel enchi project. ... I just wish I could remember where I read it so I could confirm
    If you do locate it, please link here. I would be interested in seeing what all he has done
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1