Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,012

2 members and 1,010 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,948
Threads: 249,146
Posts: 2,572,383
Top Poster: JLC (31,651)
Welcome to our newest member, EL SING
Results 1 to 10 of 10

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I had a corn that made it to 24.

    Current oldest is my chondro, she is 17 in October
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    AbsoluteApril (04-16-2020),Bogertophis (04-14-2020),EL-Ziggy (04-14-2020),WrongPython (04-15-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1