Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,219

0 members and 1,219 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 76,049
Threads: 249,209
Posts: 2,572,708
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Results 1 to 4 of 4
  1. #1
    Registered User hikari23's Avatar
    Join Date
    03-31-2020
    Location
    Alberta, Canada
    Posts
    1
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Question Getting Confused with Recessive Morphs. Genetic Wizard Leading Me Wrong?

    Long time creeper... first time poster, here.

    I'm trying to use the Genetic Wizard on World of Ball Pythons to help me figure out where I want to go with a breeding plan. (Will be my first time trying.)

    From what I researched if breed a visual Albino x visual Piebald you will get double het albino het piebald. BUT, if you breed a visual toffee x visual albino you will get Toffinos. Why is that?

    Also, in the genetic wizard whenever I try to use "het piebald" it just comes up as a visual. For example, if I type "Fire" then "het piebald" for the same snake then want it to calculate, it shows that I typed a "Fire Pied." The calculations that it comes out with of what the offspring would be would be wrong, wouldn't it?

    Specifically, I have a visual Albino and am looking what to breed her with. Someone is selling a Pastel het albino het toffee in my area. Wondering what the outcome of that breeding pair would be.

    I'm just getting really confused. Any help at understanding is appreciated. Thanks.
    Last edited by hikari23; 04-14-2020 at 08:30 AM. Reason: Adding more info

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Getting Confused with Recessive Morphs. Genetic Wizard Leading Me Wrong?

    Quote Originally Posted by hikari23 View Post
    BUT, if you breed a visual toffee x visual albino you will get Toffinos. Why is that?
    Albino and Toffee are alleles of the same gene. Think of them as being like a SuperButter (Albino) and a SuperPhantom (Toffee). When you breed them together you get a Butter/Phantom (Toffino aka Albino/Toffee)

    Or maybe a more human analogy: Eye colour. If you have brown eyes you have two copies of the brown allele. If you have blue eyes you have two copies of the blue allele. If you have hazel eyes you have one copy of the brown allele and one copy of the blue allele

    Make sense?


    Quote Originally Posted by hikari23 View Post
    Someone is selling a Pastel het albino het toffee in my area. Wondering what the outcome of that breeding pair would be.
    Someone in your area does not know genetics LOL. The animal is either a Pastel het Albino or a Pastel het Toffee, it cannot be het for both


    Quote Originally Posted by hikari23 View Post
    Specifically, I have a visual Albino and am looking what to breed her with.
    What are you most interested in making? Do you want more Albinos? Albino combos? Toffinos? Toffino combos? Something completely different and you do not care whether it carries the Albino gene??
    Last edited by asplundii; 04-14-2020 at 09:05 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    BPnet Veteran Moose84's Avatar
    Join Date
    04-20-2019
    Posts
    291
    Thanks
    122
    Thanked 268 Times in 137 Posts

    Re: Getting Confused with Recessive Morphs. Genetic Wizard Leading Me Wrong?

    I have a visual Albino and am looking what to breed her with. Someone is selling a Pastel het albino het toffee in my area. Wondering what the outcome of that breeding pair would be.


    The calculators don't break down that far. Im not sure why it would tell you that two different recessives mixed together would make a visual albino x toffee. So your question...

    Pastel DH Albino x Toffee to a visual albino would net you the following: This is taking into consideration that the DH ALBINO X Toffee is 100% HET for the recessive genes. ie. one parent was visual for either gene. Mom was a toffee dad was an albino or one of them was a visual double recessive.

    Albinos possible het toffee
    Pastel albinos poss het toffee
    Pastel poss het albino and toffee
    poss het albino and toffee (normal looking)
    albinos

    with all this being said I know very little about toffee... I have never worked with it. This example given would be for double recessives. From a quick search Toffee is showing as recessive.



  4. #4
    BPnet Veteran Moose84's Avatar
    Join Date
    04-20-2019
    Posts
    291
    Thanks
    122
    Thanked 268 Times in 137 Posts

    Re: Getting Confused with Recessive Morphs. Genetic Wizard Leading Me Wrong?

    Quote Originally Posted by asplundii View Post
    Albino and Toffee are alleles of the same gene. Think of them as being like a SuperButter (Albino) and a SuperPhantom (Toffee). When you breed them together you get a Butter/Phantom (Toffino aka Albino/Toffee)

    Or maybe a more human analogy: Eye colour. If you have brown eyes you have two copies of the brown allele. If you have blue eyes you have two copies of the blue allele. If you have hazel eyes you have one copy of the brown allele and one copy of the blue allele

    Make sense?




    Someone in your area does not know genetics LOL. The animal is either a Pastel het Albino or a Pastel het Toffee, it cannot be het for both




    What are you most interested in making? Do you want more Albinos? Albino combos? Toffinos? Toffino combos? Something completely different and you do not care whether it carries the Albino gene??
    Listen to this guy.. Hahaha I figured it had something to do with alleles. Ill shut up now..

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1