» Site Navigation
2 members and 828 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,900
Threads: 249,095
Posts: 2,572,066
Top Poster: JLC (31,651)
|
-
-
-
Re: Getting Confused with Recessive Morphs. Genetic Wizard Leading Me Wrong?
 Originally Posted by hikari23
BUT, if you breed a visual toffee x visual albino you will get Toffinos. Why is that?
Albino and Toffee are alleles of the same gene. Think of them as being like a SuperButter (Albino) and a SuperPhantom (Toffee). When you breed them together you get a Butter/Phantom (Toffino aka Albino/Toffee)
Or maybe a more human analogy: Eye colour. If you have brown eyes you have two copies of the brown allele. If you have blue eyes you have two copies of the blue allele. If you have hazel eyes you have one copy of the brown allele and one copy of the blue allele
Make sense?
 Originally Posted by hikari23
Someone is selling a Pastel het albino het toffee in my area. Wondering what the outcome of that breeding pair would be.
Someone in your area does not know genetics LOL. The animal is either a Pastel het Albino or a Pastel het Toffee, it cannot be het for both
 Originally Posted by hikari23
Specifically, I have a visual Albino and am looking what to breed her with.
What are you most interested in making? Do you want more Albinos? Albino combos? Toffinos? Toffino combos? Something completely different and you do not care whether it carries the Albino gene??
Last edited by asplundii; 04-14-2020 at 09:05 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Getting Confused with Recessive Morphs. Genetic Wizard Leading Me Wrong?
I have a visual Albino and am looking what to breed her with. Someone is selling a Pastel het albino het toffee in my area. Wondering what the outcome of that breeding pair would be.
The calculators don't break down that far. Im not sure why it would tell you that two different recessives mixed together would make a visual albino x toffee. So your question...
Pastel DH Albino x Toffee to a visual albino would net you the following: This is taking into consideration that the DH ALBINO X Toffee is 100% HET for the recessive genes. ie. one parent was visual for either gene. Mom was a toffee dad was an albino or one of them was a visual double recessive.
Albinos possible het toffee
Pastel albinos poss het toffee
Pastel poss het albino and toffee
poss het albino and toffee (normal looking)
albinos
with all this being said I know very little about toffee... I have never worked with it. This example given would be for double recessives. From a quick search Toffee is showing as recessive.
-
-
Re: Getting Confused with Recessive Morphs. Genetic Wizard Leading Me Wrong?
 Originally Posted by asplundii
Albino and Toffee are alleles of the same gene. Think of them as being like a SuperButter (Albino) and a SuperPhantom (Toffee). When you breed them together you get a Butter/Phantom (Toffino aka Albino/Toffee)
Or maybe a more human analogy: Eye colour. If you have brown eyes you have two copies of the brown allele. If you have blue eyes you have two copies of the blue allele. If you have hazel eyes you have one copy of the brown allele and one copy of the blue allele
Make sense?
Someone in your area does not know genetics LOL. The animal is either a Pastel het Albino or a Pastel het Toffee, it cannot be het for both
What are you most interested in making? Do you want more Albinos? Albino combos? Toffinos? Toffino combos? Something completely different and you do not care whether it carries the Albino gene??
Listen to this guy.. Hahaha I figured it had something to do with alleles. Ill shut up now..
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|