» Site Navigation
2 members and 958 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,947
Threads: 249,146
Posts: 2,572,383
Top Poster: JLC (31,651)
|
-
Registered User
How old is your oldest snake?
I'm curious to know how old everyone's oldest snake is or has been. It would be interesting to find out how old the oldest snake on the forums is.
To get it started, my oldest is 12.
1.0 Brazilian Rainbow Boa (Charade)
0.1 Jungle Carpet Python (Cairo)
1.0 Ball Python (Bean)
-
The Following 4 Users Say Thank You to Ksophiat For This Useful Post:
AbsoluteApril (04-16-2020),Bogertophis (04-13-2020),EL-Ziggy (04-14-2020),WrongPython (04-15-2020)
-
The oldest I've ever had? 19 years old (and that's how long I had him too). The oldest I currently have? That's hard to say because she's a wild caught adult. I'd say at least 4, maybe 5 years old.
Start your own dubia roach colony with Roach Rancher!
Instagram - @AliceAnaconda
0.1.0 Cat "Anna"
-----
1.1.0 Emerald Tree Boa "Amanda & Samantha"
0.1.0 Merauke Scrub Python "Victoria"
0.1.0 Titanium Reticulated Python "Alice"
1.0.0 Eastern Indigo
-----
0.0.4 Alligator Snapping Turtle "Deborah"
0.0.2 Florida Snapping Turtles
0.0.1 Cuvier's Dwarf Caiman "Caroline"
0.0.1 100% Het Black Dragon Asian Water Monitor
-----
0.0.1 Antilles Pink Toe Tarantula "Katherine"
-
The Following 3 Users Say Thank You to wnateg For This Useful Post:
AbsoluteApril (04-16-2020),EL-Ziggy (04-14-2020),WrongPython (04-15-2020)
-
I got my first ball python in 2006 I think and he was at least a year then so around 15 years old now.
2.0 Python brongersmai
1.1 Python breitensteini
1.0 Python curtus
1.0.1 Python regius
1.0 Acrantophis dumerili
1.0 Boa constrictor
0.1 Heterodon nasiscus nasiscus
0.0.1 Pantherophis guttatus
-
The Following 3 Users Say Thank You to GoingPostal For This Useful Post:
AbsoluteApril (04-16-2020),EL-Ziggy (04-14-2020),WrongPython (04-15-2020)
-
My current oldest is 21 years (an Okeetee corn snake)...in the past, I've had some (other kinds) get to 25-26 years.
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following 4 Users Say Thank You to Bogertophis For This Useful Post:
AbsoluteApril (04-16-2020),EL-Ziggy (04-14-2020),GoingPostal (04-14-2020),WrongPython (04-15-2020)
-
Re: How old is your oldest snake?
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
The Following 4 Users Say Thank You to dr del For This Useful Post:
AbsoluteApril (04-16-2020),EL-Ziggy (04-14-2020),GoingPostal (04-14-2020),WrongPython (04-15-2020)
-
I had a corn that made it to 24.
Current oldest is my chondro, she is 17 in October
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 4 Users Say Thank You to asplundii For This Useful Post:
AbsoluteApril (04-16-2020),Bogertophis (04-14-2020),EL-Ziggy (04-14-2020),WrongPython (04-15-2020)
-
How old is your oldest snake?
Nineteen year old BP
Last edited by Reinz; 04-14-2020 at 04:53 PM.
The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.
1.2 Coastal Carpet Pythons
Mack The Knife, 2013
Lizzy, 2010
Etta, 2013
1.1 Jungle Carpet Pythons
Esmarelda , 2014
Sundance, 2012
2.0 Common BI Boas, Punch, 2005; Butch, age?
0.1 Normal Ball Python, Elvira, 2001
0.1 Olive (Aussie) Python, Olivia, 2017
Please excuse the spelling in my posts. Auto-Correct is my worst enema.
-
The Following 4 Users Say Thank You to Reinz For This Useful Post:
AbsoluteApril (04-16-2020),Bogertophis (04-14-2020),EL-Ziggy (04-14-2020),WrongPython (04-15-2020)
-
Re: How old is your oldest snake?
My 7 y/o bullsnake She-RA.

3.0 Carpet Pythons, 1.1 Bullsnakes
1.0 Olive Python 1.0 Scrub Python,
1.0 BI, 0.1 BCO
-
The Following 3 Users Say Thank You to EL-Ziggy For This Useful Post:
AbsoluteApril (04-16-2020),Bogertophis (04-14-2020),WrongPython (04-15-2020)
-
I currently have 2 boas that are both 22 yrs (unrelated), I got them when they were 4. Also have a 19 year old corn snake, 19 year old Amazon Tree boa and 19 year old Hog Isle boa that I've had since they were babies.
I had a boa that was 28yrs when we had to have her euthanized in 2017, she was my first snake and I had her for in my care for 19 of those years.
Been keeping since 1998 and you can see based on these numbers in 2001 I got quite a few new additions haha
-
The Following 2 Users Say Thank You to AbsoluteApril For This Useful Post:
EL-Ziggy (04-16-2020),WrongPython (04-16-2020)
-
The snake I had the longest would have been 14 this year, he passed away under someone else's care (a flood). My current oldest will be 12 in July I believe. I've only had her maybe 3-4 years.
8.3 Boa imperator ('15 sunglow "Nymeria," '11 normal "Cloud," '16 anery motley "Crona," '10 ghost "Howl," '08 jungle "Dominika," '22 RC pastel hypo jungle "Aleister," '22 pastel normal "Gengar," '22 orangasm hypo "Daemon," '22 poss jungle "Jinzo," '22 poss jungle "Calcifer," '22 motley "Guin")
1.4 Boa imperator; unnamed '22 hbs
3.3 Plains garter snakes
1.2 checkered garter snakes (unnamed)
~RIP~
2.2 Brazilian rainbow boa ('15 Picasso stripe BRBs "Guin" and "Morzan, and '15 hypo "Homura", '14 normal "Sanji")
1.0 garter snake ('13 albino checkered "Draco")
1.0 eastern garter ('13 "Demigod)
0.0.1 ball python ('06 "Bud")
-
The Following User Says Thank You to CloudtheBoa For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|