Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,407

0 members and 1,407 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,131
Posts: 2,572,298
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 10

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Acid Ball Pythons

    Quote Originally Posted by rufretic View Post
    I'm not sure if it's been done yet but blackhead should be interesting.
    Acid Blackhead has been done, it was interesting but not overwhelming. The Acid Blackhead BlkPastel though... That will blow your damn mind:

    https://community.morphmarket.com/up...f8e7a2ec8.jpeg
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    rufretic (03-26-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1