Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,469

1 members and 2,468 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,087
Threads: 249,228
Posts: 2,572,846
Top Poster: JLC (31,651)
Welcome to our newest member, jolteons
Results 1 to 6 of 6
  1. #1
    Registered User
    Join Date
    03-13-2020
    Posts
    1
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Help pick which BEL ball python to buy!

    Hi everyone! So I’m planning on purchasing my first BEL Tuesday when I get paid but I’m so conflicted on which one I should get. I’m trying to find one that won’t have any markings/ shadows on the head, won’t yellow and will stay pure white. I want the purest one possible but I have no idea which of these I should buy. Can someone possibly give me some advice? I am trying to choose between the ones in the picture below

    https://imgur.com/gallery/bFnH7BP

  2. #2
    Registered User
    Join Date
    11-22-2019
    Posts
    1
    Thanks
    0
    Thanked 0 Times in 0 Posts
    I got my BEL from Wilbanks and hes perfect! No markings or anything. And he is so chill and cool. Had a great experience with the so I always reccomend them to people!

  3. #3
    BPnet Senior Member CALM Pythons's Avatar
    Join Date
    12-31-2016
    Location
    None Ya
    Posts
    2,770
    Thanks
    3,090
    Thanked 2,442 Times in 1,365 Posts
    Images: 23

    Re: Help pick which BEL ball python to buy!

    Do a lot of research. Several have yellow on their backs and head markings. Do not get a Vin Russo White Diamond. I bought directly from him, paid good money too and lots of blotching on mine and you can see the head pattern. It looked really dirty the first 2 yers. It took 3 years to fade that dirty look but it will never be clean like the Lessers Mojave etc.. that is probably the Cleanest out there but make sure you see pictures of it in correct lighting from a reputable breeder.


    Sent from my iPhone using Tapatalk
    Name: Christian
    0.1 Albino Ball (Sophie)
    0.1 Russo White Diamond (Grace)
    1.0 Hypo Burmese (Giacomo/AKA Jock)
    1.2 Razors Edge/Gotti & American Pit Bull
    ----------
    1.1 Albino/Normal Burmese (Mr & Mrs Snake)
    1.0 Albino Ball (Sully)

  4. #4
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: Help pick which BEL ball python to buy!

    First thing is the descrition on two of them - it is impossible to get a "super butter mojave" - I'm guessing they meant butter mojave or lesser mojave. It's a small point but butter/lesser and mojave all share the same locus - and you can only have two genes per locus.

    But the lesser/ butter mojave is probably the one I would go for as super lessers and butters can have eye issues that the butter mojave and the lesser mojave do not.

    To be honest I would pick between the two on the right - the bottom one having ghost in the mix may be important if that fits in with any breeding goals you may have but both of them look really nice to my eye.
    Last edited by dr del; 03-24-2020 at 12:33 AM.
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  5. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help pick which BEL ball python to buy!

    Quote Originally Posted by Lovelywolf97 View Post
    I’m trying to find one that won’t have any markings/ shadows on the head, won’t yellow and will stay pure white.
    Having owned three of the four types of white snake - BluEL, Ivory, and BlkEL - I will tell you that every BluEL will develop some kind of stripe and will yellow up some, it is inherent to the mutation. Granted it is more faded in some than others but all of them have it. As Del said, the Hypo Butter/Mojave is probably your best bet but I had a 2000g female of that exact combo and she definitely had a stripe that you could make out.

    If you want a truly eye-blindingly stark white snake then your best bet is an all-white BlkEL or all-white Pied. My SuperFire SuperPastel YB girl made my Hypo Butter/Mojave ad my Ivory Butter OD Pastel look dingy
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #6
    BPnet Veteran hilabeans's Avatar
    Join Date
    09-26-2017
    Location
    Texas
    Posts
    992
    Thanks
    1,253
    Thanked 1,252 Times in 617 Posts
    Images: 7

    Re: Help pick which BEL ball python to buy!

    My boy is a Lesser Mojave. He was stark white as a baby but - heads up - did develop a faint yellow line down his back as he hit adulthood. Zero patterning, however.

    It’s barely noticeable and I’m the only one who even detects it. I thought it would bother me a lot more than it does as he still elicits gasps from anyone who meets him - he’s just gorgeous (<- biased mom opinion).



    1.0 Lesser Mojave Ball Python "Neptune"; 1.0 Western Hognose "Murray"

    Lizards:
    1.0 Bearded Dragon "Nigel"

    Tarantulas:
    0.1 G. Rosea "Charlotte"; 0.1 B. Albopilosum "Matilda"; 0.1 C. Versicolor "Bijou"; 1.0 B. Boehmei "Lightening McQueen"

    Inverts:
    1.0 Emperor Scorpion "Boba"

    Dog & Cats:

    1.0 Doberman Pinscher "Bulleit"; 1.0 Siamese Cat "Boudreaux"; 1.0 British Shorthair Cat "Oliver”


    Goats:
    "Hazelnut" & "Huckleberry"


  7. The Following User Says Thank You to hilabeans For This Useful Post:

    Kam (03-24-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1