Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,014

1 members and 1,013 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,948
Threads: 249,146
Posts: 2,572,383
Top Poster: JLC (31,651)
Welcome to our newest member, EL SING
Results 1 to 10 of 27

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Dragon snake...

    Iranian spider-tailed viper...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (02-12-2020),Luvyna (02-12-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1