Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,864

0 members and 1,864 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,097
Threads: 249,238
Posts: 2,572,918
Top Poster: JLC (31,651)
Welcome to our newest member, JoRyMe
Results 1 to 5 of 5

Thread: Black Morphs?

  1. #1
    Registered User Fasfer's Avatar
    Join Date
    11-11-2018
    Location
    Virginia, USA
    Posts
    17
    Thanks
    7
    Thanked 2 Times in 2 Posts

    Black Morphs?

    I was wondering if there was a black morph for BPs that's actually black? I know there's a "Super Sable" but that morph is a no-no, and it's not actually black, it's brown. I also know Axanthic is an option, but I'm talking more of a morph that has no marking on it - like the blue eyed leucistic gene - to give it that jet black appearance. I've tried finding some; looking through MorphMarket, threads on here, and google, but a lot of the solid black BPs have not been actual BPs or have been photo-shopped.

    Am I just dumb?

    Thank y'all in advance for the help! And sorry if this has already been asked.
    Fasfer
    "God put the good things in life on the other side of fear..."
    -Will Smith



  2. #2
    Registered User
    Join Date
    10-19-2019
    Location
    North Eastern Arizona
    Posts
    66
    Thanks
    0
    Thanked 61 Times in 32 Posts
    Images: 3

    Re: Black Morphs?

    A lot of the solid black morphs have some risk of birth defects, mainly kinking of the spine. A super mahogany would be a good choice if you want a very dark snake with out the risk.

  3. The Following User Says Thank You to AzJohn For This Useful Post:

    Fasfer (12-16-2019)

  4. #3
    Registered User Fasfer's Avatar
    Join Date
    11-11-2018
    Location
    Virginia, USA
    Posts
    17
    Thanks
    7
    Thanked 2 Times in 2 Posts

    Re: Black Morphs?

    Yeah, I found some info on the Super Black Pastels having severe issues: kinks, wobbles etc.. So bad in some cases, a few breeders even have them marked as a "Lethal" morph, which is unfortunate because they are gorgeous snakes. I just didn't know if there was any that were worth getting, that wouldn't support the breeding of bad genes and gene traits. This helps, though! I'll definitely check 'em out.
    Fasfer
    "God put the good things in life on the other side of fear..."
    -Will Smith



  5. #4
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Black Morphs?

    As mentioned, the cinny/black pastel supers are likely to have issues. If you just want one as a pet it's not impossible to find one without issues but I wouldn't purposely breed for your own. I have hatched a bunch of Sumas and they're a really dark brown on their own but you can add ghi or a few other genes to them to make them closer to a black color which is my plan. Here are a few of my het pied sumas. They're a cool silvery black before first shed.

    Sent from my Pixel 3 using Tapatalk

  6. The Following 3 Users Say Thank You to Hannahshissyfix For This Useful Post:

    Kam (12-20-2019),ladywhipple02 (12-18-2019),Ronniex2 (08-12-2021)

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    So far, even the darkest looking combos as babies have grown up to be more deep brown as adults. I JKR's original SUMA Cinny at NARBC four years ago and it was deep black but as it matured it browned out with the ontogenic change. The SUMA GHI was, likewise, a very dark animal but it had traces of pattern on it and the last pic I saw of it it was also starting to get that brown tone to it.

    I would suspect that tadding something like Axanthic or DesertGhost, which act to strip down some of the xanthin expression, would work to make a cleaner/darker combo as an adult but the only way to know for sure would be to make it and see
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following User Says Thank You to asplundii For This Useful Post:

    Ronniex2 (08-12-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1