Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,350

1 members and 1,349 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 1 of 2 12 LastLast
Results 1 to 10 of 16
  1. #1
    Registered User
    Join Date
    11-09-2019
    Posts
    25
    Thanks
    0
    Thanked 17 Times in 9 Posts

    White "alien heads" in snakes after eggs are cut

    Hello,

    So my friend got 9 eggs from a ball python (probably retained sperm) but did not have an incubator. Neither did I but I did manage to incubate a pigeon egg once with a makeshift one. So I do it again for BP eggs, of course temp 31'C, 100% humidity. So I do it with a simple box and a heating pad underneath and thermometer probe half way in the substrate - this is first time for me, I know about BP only from reading on the internet, have zero xp on this and just wanted to try to save the eggs. (Why we didn't try maternal incubation, current owner of the female is not interested in baby snakes... long story).

    On day 56 one hatches. Normal baby, all good, on day 2 slithering around the "incubator". but rest of the 8 eggs are not hatching and it is now almost day 3. I candle the eggs and I see babies moving but of them 2 look very still, no movement at all. I was a bit scared for those 2 so I cut tiny slits - today, day 58 of incubation. Babies are OK, they are responsive, but their "alien" heads are completely white - I mean inside, outline is black-gray. The mother is a pastel and father is also. Does this means they are super pastel or something or are the babies underdeveloped? Are undeveloped babies with little color, or is there another problem? (I do not expect them to be some fancy morph, or that parents were hets, they were sold cheap and were not from a good breeder).

    I do not want to poke further in the egg to see. I think I already did a lot of damage by cutting them maybe too early. I have added some warmed (to 31'C) saline to both eggs as they look a bit dry. I have covered the slits with pieces of saline infused tissue paper. And I am mortified now.

    Eggs are all clumped together, so they can distribute heat. I check with laser thermometer but there is some uneven temperature. So temps are constant, but the heat pad heats uneven, so one place it goes 30-31'C, but on another spot 28-29'C.

    What do you think?

  2. #2
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts

    Re: White "alien heads" in snakes after eggs are cut

    Generally if one hatched the others are not far behind they should be ok with your cuts. As for what they are post pics and we can help identify

    Sent from my SM-G903W using Tapatalk
    Laziness is nothing more than the habit of resting before you get tired.

  3. The Following User Says Thank You to StillBP For This Useful Post:

    dr del (12-01-2019)

  4. #3
    Registered User
    Join Date
    11-09-2019
    Posts
    25
    Thanks
    0
    Thanked 17 Times in 9 Posts

    Re: White "alien heads" in snakes after eggs are cut

    Thank you for your answer.

    I really don't care what they are as long as they are OK. I will take a picture tomorrow when I top the water in the egg again. I don't want to disturb them more than I have to.
    I am just worried they look very pale, and thus that they are undeveloped. I could not find pictures of BP fetal development anywhere so I don't know when do they get their colors.

  5. #4
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts

    Re: White "alien heads" in snakes after eggs are cut

    They very last thing they develop is color. I would just let them do their thing. They should be fine but I wouldn't add fluid to the eggs unless absolutely necessary. At this point they should be drying up absorbing all the fluids

    Sent from my SM-G903W using Tapatalk
    Last edited by StillBP; 12-01-2019 at 05:33 PM.
    Laziness is nothing more than the habit of resting before you get tired.

  6. #5
    Registered User
    Join Date
    11-09-2019
    Posts
    25
    Thanks
    0
    Thanked 17 Times in 9 Posts

    Re: White "alien heads" in snakes after eggs are cut

    Thank you!
    Those 2 were very dimpled. Basically flat as a pancake, so I was afraid they are dehydrated. I will post pictures of the whole thing tomorrow. I will not add more saline tomorrow!
    I do hope I don't cause any deaths with my ignorance. I really want to save these poor babies and give them a chance.

  7. #6
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts

    Re: White "alien heads" in snakes after eggs are cut

    Yes dimples are actually a good sign that they are close to hatching. They would have absorbed most of the fluids inside the egg hence why it sucks in. Ball babies are surprising resilient to our mistakes. Tho you still want to avoid mistakes if possible. I've seen eggs where the breeder mistook for a different clutch and cut extremely early and the babies were all fine. Like I said just let them do their thing abd they should do fine

    Sent from my SM-G903W using Tapatalk
    Laziness is nothing more than the habit of resting before you get tired.

  8. The Following User Says Thank You to StillBP For This Useful Post:

    dr del (12-03-2019)

  9. #7
    Registered User
    Join Date
    11-09-2019
    Posts
    25
    Thanks
    0
    Thanked 17 Times in 9 Posts
    Hello,

    So officially day 3 and no sign of new baby snakes. I put again wet tissue paper on the slits, which keeps the cuts nicely closed. Eggs are now bit dirty because BP that hatched is moving around a lot.

    This is the box with the eggs. You can see slit I made on one, and second one is quite dirty looking one in lower right corner - it has a bigger slit but i cover it with wet tissue paper which keeps it closed:
    https://ibb.co/vxdxjhD

    And this is inside of the the eggs, the one I cut first and made a bigger cut:
    https://ibb.co/HnTQTqJ

    I can't do a good image without flash, but as you can see, snake is white. While looking around I saw also yolk sac, it was yellow, looked OK. I looked around youtube and looks like snakes that will be yellow later on are white when the eggs are cut. Can this be the case, so these are super pastels maybe, or there is something wrong with the snake?

    Small plastic water dish is not to hold the humidity but just to make sure the baby that has hatched has water if it needs it.

  10. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: White "alien heads" in snakes after eggs are cut

    Quote Originally Posted by Rosa View Post
    So my friend got 9 eggs from a ball python (probably retained sperm) ... The mother is a pastel and father is also. Does this means they are super pastel or something or are the babies underdeveloped?
    Something you should consider is that the male has nothing to do with this equation and that instead of retained sperm what you have is a parthenogenesis event. And if that is the case, then you might see some developmental problems
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (12-02-2019),dr del (12-03-2019)

  12. #9
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,572
    Thanks
    2,977
    Thanked 10,009 Times in 4,841 Posts
    Images: 34
    I would move the one neonate that is out over to a hatchling rack so it can't contaminate the other eggs.

  13. The Following User Says Thank You to bcr229 For This Useful Post:

    dr del (12-03-2019)

  14. #10
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: White "alien heads" in snakes after eggs are cut

    Kudos for managing to improvise an effective incubator.

    At three days after the first one hatched on its own I would probably cut the rest and just monitor them carefully - adding saline is fine but I generally only add water (stored in the incubator to avoid temp shocks ) and don't bother resealing the cuts as the integrity is compromised anyway and it may prevent you from seeing problems like debris or mould forming in the egg white ( remove it with a q-tip when you see it ) the blood vessels in the egg drain back inside the snake in the final stages so you can use that to make sure things are going well.

    I look forward to seeing how they do for you.
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1