Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,177

1 members and 1,176 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 16

Threaded View

  1. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: White "alien heads" in snakes after eggs are cut

    Quote Originally Posted by Rosa View Post
    So my friend got 9 eggs from a ball python (probably retained sperm) ... The mother is a pastel and father is also. Does this means they are super pastel or something or are the babies underdeveloped?
    Something you should consider is that the male has nothing to do with this equation and that instead of retained sperm what you have is a parthenogenesis event. And if that is the case, then you might see some developmental problems
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (12-02-2019),dr del (12-03-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1