» Site Navigation
0 members and 1,890 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
White "alien heads" in snakes after eggs are cut
Hello,
So my friend got 9 eggs from a ball python (probably retained sperm) but did not have an incubator. Neither did I but I did manage to incubate a pigeon egg once with a makeshift one. So I do it again for BP eggs, of course temp 31'C, 100% humidity. So I do it with a simple box and a heating pad underneath and thermometer probe half way in the substrate - this is first time for me, I know about BP only from reading on the internet, have zero xp on this and just wanted to try to save the eggs. (Why we didn't try maternal incubation, current owner of the female is not interested in baby snakes... long story).
On day 56 one hatches. Normal baby, all good, on day 2 slithering around the "incubator". but rest of the 8 eggs are not hatching and it is now almost day 3. I candle the eggs and I see babies moving but of them 2 look very still, no movement at all. I was a bit scared for those 2 so I cut tiny slits - today, day 58 of incubation. Babies are OK, they are responsive, but their "alien" heads are completely white - I mean inside, outline is black-gray. The mother is a pastel and father is also. Does this means they are super pastel or something or are the babies underdeveloped? Are undeveloped babies with little color, or is there another problem? (I do not expect them to be some fancy morph, or that parents were hets, they were sold cheap and were not from a good breeder).
I do not want to poke further in the egg to see. I think I already did a lot of damage by cutting them maybe too early. I have added some warmed (to 31'C) saline to both eggs as they look a bit dry. I have covered the slits with pieces of saline infused tissue paper. And I am mortified now.
Eggs are all clumped together, so they can distribute heat. I check with laser thermometer but there is some uneven temperature. So temps are constant, but the heat pad heats uneven, so one place it goes 30-31'C, but on another spot 28-29'C.
What do you think?
-
-
Re: White "alien heads" in snakes after eggs are cut
Generally if one hatched the others are not far behind they should be ok with your cuts. As for what they are post pics and we can help identify
Sent from my SM-G903W using Tapatalk
Laziness is nothing more than the habit of resting before you get tired.
-
The Following User Says Thank You to StillBP For This Useful Post:
-
Registered User
Re: White "alien heads" in snakes after eggs are cut
Thank you for your answer.
I really don't care what they are as long as they are OK. I will take a picture tomorrow when I top the water in the egg again. I don't want to disturb them more than I have to.
I am just worried they look very pale, and thus that they are undeveloped. I could not find pictures of BP fetal development anywhere so I don't know when do they get their colors.
-
-
Re: White "alien heads" in snakes after eggs are cut
They very last thing they develop is color. I would just let them do their thing. They should be fine but I wouldn't add fluid to the eggs unless absolutely necessary. At this point they should be drying up absorbing all the fluids
Sent from my SM-G903W using Tapatalk
Last edited by StillBP; 12-01-2019 at 05:33 PM.
Laziness is nothing more than the habit of resting before you get tired.
-
-
Registered User
Re: White "alien heads" in snakes after eggs are cut
Thank you!
Those 2 were very dimpled. Basically flat as a pancake, so I was afraid they are dehydrated. I will post pictures of the whole thing tomorrow. I will not add more saline tomorrow!
I do hope I don't cause any deaths with my ignorance. I really want to save these poor babies and give them a chance.
-
-
Re: White "alien heads" in snakes after eggs are cut
Yes dimples are actually a good sign that they are close to hatching. They would have absorbed most of the fluids inside the egg hence why it sucks in. Ball babies are surprising resilient to our mistakes. Tho you still want to avoid mistakes if possible. I've seen eggs where the breeder mistook for a different clutch and cut extremely early and the babies were all fine. Like I said just let them do their thing abd they should do fine
Sent from my SM-G903W using Tapatalk
Laziness is nothing more than the habit of resting before you get tired.
-
The Following User Says Thank You to StillBP For This Useful Post:
-
Registered User
Hello,
So officially day 3 and no sign of new baby snakes. I put again wet tissue paper on the slits, which keeps the cuts nicely closed. Eggs are now bit dirty because BP that hatched is moving around a lot.
This is the box with the eggs. You can see slit I made on one, and second one is quite dirty looking one in lower right corner - it has a bigger slit but i cover it with wet tissue paper which keeps it closed:
https://ibb.co/vxdxjhD
And this is inside of the the eggs, the one I cut first and made a bigger cut:
https://ibb.co/HnTQTqJ
I can't do a good image without flash, but as you can see, snake is white. While looking around I saw also yolk sac, it was yellow, looked OK. I looked around youtube and looks like snakes that will be yellow later on are white when the eggs are cut. Can this be the case, so these are super pastels maybe, or there is something wrong with the snake?
Small plastic water dish is not to hold the humidity but just to make sure the baby that has hatched has water if it needs it.
-
-
Re: White "alien heads" in snakes after eggs are cut
 Originally Posted by Rosa
So my friend got 9 eggs from a ball python (probably retained sperm) ... The mother is a pastel and father is also. Does this means they are super pastel or something or are the babies underdeveloped?
Something you should consider is that the male has nothing to do with this equation and that instead of retained sperm what you have is a parthenogenesis event. And if that is the case, then you might see some developmental problems
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
bcr229 (12-02-2019),dr del (12-03-2019)
-
I would move the one neonate that is out over to a hatchling rack so it can't contaminate the other eggs.
-
The Following User Says Thank You to bcr229 For This Useful Post:
-
Re: White "alien heads" in snakes after eggs are cut
Kudos for managing to improvise an effective incubator. 
At three days after the first one hatched on its own I would probably cut the rest and just monitor them carefully - adding saline is fine but I generally only add water (stored in the incubator to avoid temp shocks ) and don't bother resealing the cuts as the integrity is compromised anyway and it may prevent you from seeing problems like debris or mould forming in the egg white ( remove it with a q-tip when you see it ) the blood vessels in the egg drain back inside the snake in the final stages so you can use that to make sure things are going well.
I look forward to seeing how they do for you.
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|