Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

> FAQ

» Online Users: 685

0 members and 685 guests

No Members online

Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,106
Posts: 2,572,115
Top Poster: JLC (31,651)

Welcome to our newest member, Pattyhud

Results 1 to 10 of 26

Thread: Animal Plastics (AP) bought a Bigger Facility. [emoji1373][emoji1373][emoji1373]

Thread Tools
- Show Printable Version
Display
- Switch to Linear Mode
- Switch to Hybrid Mode
- Threaded Mode

Threaded View

Previous Post

Next Post

11-14-2019, 10:10 AM #12
asplundii

View Profile

View Forum Posts

View Blog Entries

View Gallery Uploads
BPnet Veteran

Join Date

10-17-2008

Posts

906

Thanks

103

Thanked 722 Times in 382 Posts
Re: Animal Plastics (AP) bought a Bigger Facility.

Originally Posted by 303_enfield

I'm three months into the "quick ship" cages.

I am 20 weeks in on my order...

actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Reply With Quote

Quick Navigation Caging Forum Top

« Previous Thread | Next Thread »

Posting Permissions

You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
[VIDEO] code is On
HTML code is Off

Powered by vBadvanced CMPS v4.2.1

All times are GMT -4. The time now is 06:53 PM.

Copyright © 2003-2025 Ball-Pythons.net. All Rights Reserved.