» Site Navigation
2 members and 2,707 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,050
Threads: 249,210
Posts: 2,572,718
Top Poster: JLC (31,651)
|
-
Registered User
Granite and asphalts?
I think both have the YB gene in them, but what is the difference btwn them and they are made by what pairing?
Thanks,
mike
-
-
Re: Granite and asphalts?
Granite is a genetic morph all on its own. Asphalt is also a single gene morph allellic to yellow belly but different.
Kaos Balls
-
The Following User Says Thank You to Godzilla78 For This Useful Post:
-
Re: Granite and asphalts?
To clarify what that means here is a double gene yellowbelly.
Link to a good page.
And here is the result of a yellowbelly asphalt.
Link.
And the yellowbelly granite.
link.
So while they are not the same morph they exist on the same genetic location ( called allellic )
And this means a freeway bred to a normal will produce only yellowbellies and asphalt but no normals and no freeways.
del
Last edited by dr del; 10-19-2019 at 09:37 PM.
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
The Following User Says Thank You to dr del For This Useful Post:
-
Just going to clarify that I believe that the OP means Gravel and not Granite
Gravel is allelic with the YB group
Granite is a wholly unrelated morph
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
In layman's terms they are all very similar visually as single genes, a kind of sub trait of the yellow belly gene. But which when bred together produce different results.
Yellow Belly X Yellow Belly = Super yellow belly (more commonly known as an Ivory).
Gravel X Yellow Belly = Highway
Asphalt X Yellow Belly = Freeway
There are also at least two other similar genes.
Spark X Yellow Belly = Puma
Specter X Yellow Belly = Superstripe
Hope this helps?
Last edited by Copperman05; 10-21-2019 at 01:53 PM.
-
The Following User Says Thank You to Copperman05 For This Useful Post:
-
Re: Granite and asphalts?
 Originally Posted by asplundii
Just going to clarify that I believe that the OP means Gravel and not Granite
Gravel is allelic with the YB group
Granite is a wholly unrelated morph
Good point - I should go to bed earlier to avoid making these mistakes.
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|