» Site Navigation
2 members and 579 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Re: Uncommon/Underrated Snakes?
 Originally Posted by scobro
That would be cool to see.
I've always like the look of a Mandarin Rat. Never seen one first hand but the videos et al, the yellow and black is just radiant. And I'm not even a Steelers fan.

Mandarins are gorgeous!!! I love the black and yellow, it just pops so beautifully.
Mangroves are another I'd like to see more commonly in captivity. Another example of beautiful black and yellow.
No Steelers fan here either (Go Pats!!) but I am a die hard Boston Bruins fan! So the black and yellow works there!!
-
-
Re: Uncommon/Underrated Snakes?
 Originally Posted by Craiga 01453
I stand corrected. Apologies.
And I was under the belief that drop for drop their venom is among the most lethal. If I'm wrong I apologize. I try not to share info unless I'm confident I'm right. There's already enough false info on the internet, I don't need to be adding to it. Hahhahaa.
I was doing reading about gaboon vipers, and they have the "highest venom yield of any snake."
That might be what you're thinking of.
Start your own dubia roach colony with Roach Rancher!
Instagram - @AliceAnaconda
0.1.0 Cat "Anna"
-----
1.1.0 Emerald Tree Boa "Amanda & Samantha"
0.1.0 Merauke Scrub Python "Victoria"
0.1.0 Titanium Reticulated Python "Alice"
1.0.0 Eastern Indigo
-----
0.0.4 Alligator Snapping Turtle "Deborah"
0.0.2 Florida Snapping Turtles
0.0.1 Cuvier's Dwarf Caiman "Caroline"
0.0.1 100% Het Black Dragon Asian Water Monitor
-----
0.0.1 Antilles Pink Toe Tarantula "Katherine"
-
The Following User Says Thank You to wnateg For This Useful Post:
Craiga 01453 (10-08-2019)
-
Re: Uncommon/Underrated Snakes?
 Originally Posted by wnateg
Thank you. I knew I saw something along those lines.
-
-
Registered User
Re: Uncommon/Underrated Snakes?
 Originally Posted by scobro
That would be cool to see.
I've always like the look of a Mandarin Rat. Never seen one first hand but the videos et al, the yellow and black is just radiant. And I'm not even a Steelers fan.

Those are stunning!
1.0 Normal BP
0.0.1 Albino Corn Snake
-
-
Savu pythons and Mandarin rats have already been mentioned but I will echo them.
I would love to see more species of Oligodon other than purpurascens enter the hobby. Would be nice to see Rhamphiophis become more readily bred in captivity as well. Would also like to see alterna get back some of the respect they used to have back in the day.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Uncommon/Underrated Snakes?
Someone mentioned African House snakes and I agree... super under-rated and easy to keep. An albino African House snake has been on my list of wants for a bit, but I need to get my reptile room/office reorganized first.
-
The Following User Says Thank You to ladywhipple02 For This Useful Post:
-
Those Mandarin Rats are awesome!!
-
-
Registered User
I used to think, for the most part, all snakes were beautiful looking in their own way, but then I saw the Elephant Trunk snake; not all snakes are beautiful looking in their own way. That little bugger just looks wrong. They are uncommon, not sure about the underrated part.
Does anyone know/like these flabby skinned creatures?
-
-
Re: Uncommon/Underrated Snakes?
 Originally Posted by scobro
I used to think, for the most part, all snakes were beautiful looking in their own way, but then I saw the Elephant Trunk snake; not all snakes are beautiful looking in their own way. That little bugger just looks wrong. They are uncommon, not sure about the underrated part.
Does anyone know/like these flabby skinned creatures?
Ha! Great reply! And I gotta agree, those buggers are, well... less than pretty. It almost looks like they never fully evolved or developed, hahaha.
Last edited by Craiga 01453; 10-09-2019 at 10:52 AM.
-
-
Re: Uncommon/Underrated Snakes?
Once I find a stable supply of quail eggs, (looking at a few stores nearby when I get a chance). I'm going to try to pickup
a pair of Egg eating snakes, they can be housed together , and eat strictly smaller eggs. Chicken eggs are too big. hopefully next spring maybe
still working on getting the 2 baby pythons I acquired a month ago stable and going before adding anymore.
But I think these guys are really Cool.
-
The Following 4 Users Say Thank You to Gocntry For This Useful Post:
cletus (10-09-2019),John1982 (10-09-2019),TopazEye (10-09-2019),vivi (04-03-2020)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|