Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,444

1 members and 1,443 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,917
Threads: 249,123
Posts: 2,572,228
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
Results 1 to 6 of 6
  1. #1
    Registered User
    Join Date
    01-24-2016
    Posts
    30
    Thanks
    21
    Thanked 7 Times in 6 Posts
    Images: 2

    Frozen feeder lizards??

    So I'm looking into getting Asian Vine snakes. I'm no stranger to a variety of snake species. I work with everything from a normal ball python to Louisiana pine snakes. I have indigo's and corn snakes, rosy boas and house snakes. I'm basically on every Spectrum left and right lol
    But everything I own is a mouse or bird eater. I've never delt with a straight lizard eater before. Feeder lizards are not going to be easy for me to purchase locally. I started to read that a lot of Asian Vine snakes have parasite issues from being caught in the wild.
    I started to read more and found out that there's a big problem with feeder lizards caring mass of parasites loads that also taint captive-born specimens.
    Well looking into it, I couldn't really find an answer to this. Why are there no Frozen lizards available as a food source?
    In my mind, Frozen thawed would kill any parasite load and make it safe for the snake, Thus eradicating this massive parasite problem that we're dealing with in these species.
    I've never personally tried to defrost a lizard and feed it off. Is there reason that no one else is trying? Do they not thaw well? Is there some little common knowledge about it that I've been kept out of the loop with?
    Any insight is appreciated! Thank you so much!

  2. #2
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,810
    Thanks
    29,404
    Thanked 20,585 Times in 12,301 Posts
    Not sure where you're located but found these:
    https://undergroundreptiles.com/prod...egory/feeders/
    https://www.lllreptile.com/products/...-anole-lizards

    Not as many sources of feeder lizards because not as much demand, including at my house. I've kept a TX longnose snake (a lizard feeder by nature) for many years
    now, but happily she eats f/t fuzzy mice. I know of no issues with f/t lizards off-hand. Maybe others will chime in here with practical experience...

    I think there many be other sources of feeder lizards, btw...I am not endorsing the above companies, I've not ordered from them (I raise my own rodents).
    You might have to buy live & freeze them yourself?
    Last edited by Bogertophis; 10-08-2019 at 12:39 AM.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  3. #3
    Registered User
    Join Date
    01-24-2016
    Posts
    30
    Thanks
    21
    Thanked 7 Times in 6 Posts
    Images: 2

    Re: Frozen feeder lizards??

    Thanks so much for the reply!
    Yeah I've been looking through the week at different places selling live lizards. The Asian vines I'm getting are babies, and no one seems to sell other sizes of the lizards. It's all just "feeder anole" or "house geckos" lol
    I could probably do some digging an email a couple people to see if I can get smaller sizes, but I was just really interested in the Frozen thawed lizard idea.

    As silly as it sounds, I actually have a hard time feeding live lizards. I know they're just anoles and house geckos, but I love them so much lmao
    I can feed off a button quail without so much as a blink. I can feed off any size of rat or Mouse without a problem.
    But the second I have to look at a lizard and feed it to a snake? APPARENTLY THATS WHERE MY LINE WAS!

    I was reading that they're pretty difficult to switch. I'm not at all opposed to starting that battle though! If I can get these guys eating rodents or even button quail, I would be ecstatic.

    I am still extremely curious on the Frozen lizard thing though. If anyone else has anything to add, please do!

  4. The Following User Says Thank You to damein For This Useful Post:

    Bogertophis (10-08-2019)

  5. #4
    BPnet Veteran
    Join Date
    01-18-2018
    Posts
    649
    Thanks
    34
    Thanked 802 Times in 393 Posts
    Fyi, Underground advertise a lot of items on their website that they don't have (yet). I know we asked them 2 weeks ago about lizard feeders and they told us they had none, although their website says otherwise. I would call ahead if you are going to order from them. Their rodent feeders are terrible though, wrong size and crushed skinny feeders.

  6. The Following User Says Thank You to Cheesenugget For This Useful Post:

    Bogertophis (10-08-2019)

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    One thing I would caution you with is that Asian vines are very visually oriented, so trying to get them to eat F/T might be a challenge in and of itself.

    What you might want to look into instead is to start your own colony of anoles or house geckos, that way you have live feeders on hand and, since they are CBB, they would be parasite free
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (10-08-2019)

  9. #6
    Registered User
    Join Date
    01-24-2016
    Posts
    30
    Thanks
    21
    Thanked 7 Times in 6 Posts
    Images: 2

    Re: Frozen feeder lizards??

    Thank you for the suggestion.
    I have given some thought in breeding my own feeder lizards. House geckos are right up my ally.
    I just dont have the room at this moment to start such a project. But it's definitely on the back burner!

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1