Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,257

1 members and 1,256 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,142
Posts: 2,572,362
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 6 of 6

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Questions about a possible Mojave combo

    Quote Originally Posted by Ax01 View Post
    but Enchi Pieds are high pattern.
    Enchi by itself sure.

    Pin also tends to make for high patterned Pieds but BlkPastel Pins are high white.

    Pied Spotnose are basically all-white. Pied Mojaves are >60%. Stacking those together, I am not sure you can fight their combined power. I admit I might be wrong, but I know where I would lay my odds if I were a betting man
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Ax01 (08-29-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1